Table 3. miRNAs more abundantly detected by the PGM platform.
| miRNA (hsa-miR) | Fold change | p-value | Reads/million | Reads/million | Cell line | Sequence |
|---|---|---|---|---|---|---|
| (PGM: SOLiD) | (PGM) | (SOLiD) | ||||
| 3613-5pb | N.A. | 0.0062 | 24.25 | 0 | C5.2 | uguuguacuuuuuuuuuuguuc |
| 25.52x | 0.1131 | 14.55 | 0.57 | HB4a | ||
| 4455b | N.A. | 0.0472 | 10.92 | 0 | HB4a | aggguguguguguuuuu |
| N.A. | N.A. | 0 | 0 | C5.2 | ||
| 424-3pb | 118.1 | 0.0270 | 67.32 | 0.57 | HB4a | cagugcaaugauauugucaaagc |
| 6.76x | 0.1348 | 50.92 | 7.53 | C5.2 | ||
| 16-1-3pa | 67.03x | 0.0028 | 76.42 | 1.14 | HB4a | ucucccaacccuuguaccagug |
| 45.13x | 0.0084 | 61.83 | 1.37 | C5.2 | ||
| 25-5pb | 46.28x | 0.0340 | 26.38 | 0.57 | HB4a | ugucaguuugucaaauacccca |
| 19.99x | 0.0873 | 18.19 | 0.91 | C5.2 | ||
| 20a-3pa | 48.37x | 0.0274 | 1215.45 | 25.13 | HB4a | acaguagucugcacauugguua |
| 11.08x | 0.0429 | 1446.3 | 130.55 | C5.2 | ||
| let-7i-5pa | 8.16x | 0.0060 | 1659.7 | 203.35 | C5.2 | agcagcauuguacagggcuauga |
| 11.43x | 0.0406 | 1563.0 | 136.79 | HB4a | ||
| 1296-5pb | 12.75x | 0.0324 | 189.12 | 14.83 | C5.2 | uuagggcccuggcuccaucucc |
| 8.62x | 0.0797 | 118.27 | 13.71 | HB4a | ||
| 200c-3pb | 11.23x | 0.0202 | 602.52 | 53.63 | C5.2 | agguucugugauacacuccgacu |
| 5.27x | 0.1320 | 2037.88 | 386.66 | HB4a | ||
| 1307-5pb | 8.59x | 0.0180 | 1574.8 | 183.27 | C5.2 | acgcccuucccccccuucuuca |
| 6.55x | 0.0872 | 1924.16 | 293.56 | HB4a |
(a) miRNAs preferentially represented by the PGM platform for both cell lines; (b) miRNAs with significant differential representation observed for a single cell line. For each miRNA row, the top line contains the lower p-value for differential representation between SOLiD and PGM.