KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rat anti-Ki67 | ThermoFisher Scientific | Cat# 14-5698-80; RRID:AB_10853185 |
| Rabbit anti-GS | Abcam | Cat# ab49873; RRID: AB_880241 |
| Rat anti-CD31 | BD Biosciences | Cat# 550274; RRID: AB_393571 |
| Rabbit anti-Fah | Overturf et al., 1996 | N/A |
| Alexa Fluor 647-conjugated anti-rat | Jackson ImmunoResearch Labs | Cat# 212-606-168; RRID: AB_2339249 |
| DyLight 405-conjugated anti-rabbit | Jackson ImmunoResearch Labs | Cat# 711-475-152; RRID:AB_2340616 |
| Alexa Fluor 647-conjugated anti-rabbit | Jackson ImmunoResearch Labs | Cat# 711-606-152; RRID:AB_2340625 |
| Bacterial and Virus Strains | ||
| AAV8-Ttr-Cre | Malato et al., 2011 | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Tamoxifen | Sigma-Aldrich | Cat# T5648 |
| Thioacetamide (TAA) | Sigma-Aldrich | Cat# 163678 |
| 3,5-diethoxycarbonyl-1,4-dihydro-collidin (DDC) | Sigma-Aldrich | Cat# 137030 |
| carbon tetrachloride (CCl4) | Sigma-Aldrich | Cat# 270652 |
| corn oil | Sigma-Aldrich | Cat# C8267 |
| 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclo-hexanedione (NTBC) | ArkPharm | Cat# AK-55736 |
| Collagenase, type 2 | Worthington Biochemical | Cat# LS004176 |
| Hoechst 33342 | ThermoFisher Scientific | Cat# H3570 |
| reserpine | Sigma-Aldrich | Cat# 83580 |
| propidium iodide | Sigma-Aldrich | Cat# 287075 |
| SYTOX Red Dead Cell Stain | ThermoFisher Scientific | Cat# S34859 |
| TrueBlack Lipofuscin Autofluorescence Quencher | Biotium | Cat# 23007 |
| RedDot2 Far-Red Nuclear Stain | Biotium | Cat# 40061 |
| N-methylacetamide | ThermoFisher Scientific | Cat# 11409056 |
| Omnipaque 350 | GE Healthcare | Cat# 542Y |
| Triton X-100 | ThermoFisher Scientific | Cat# BP151-100 |
| 1-thioglycerol | Sigma-Aldrich | Cat# M1753 |
| MasterPure Complete DNA/RNA Purification kit | Lucigen | Cat# MC85200 |
| FastStart Essential DNA Green Master | Roche | Cat# 06402712001 |
| Experimental Models: Organisms/Strains | ||
| Mouse: Wild-type C57BL/6 | The Jackson Laboratory | Stock# 000664; RRID: IMSR_JAX:000664 |
| Mouse: B6.Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/2J (Ubc-CreERT2) | The Jackson Laboratory, Ruzankina et al., 2007 | Stock# 008085; RRID: IMSR_JAX:008085 |
| Mouse: B6.129P2-Gt(ROSA)26Sortm1(CAG-Brainbow2.1)Cle/J (Rosa-Confetti) | The Jackson Laboratory, Snippert et al., 2010 | Stock# 017492; RRID: IMSR_JAX:017492 |
| Mouse: B6;129S4-Gt(ROSA)26Sortm4(CAG-mOrange2,-EGFP,-mKate2)Zjh/J (Rosa-RGBow) | The Jackson Laboratory, He et al., 2016 | Stock# 028583; RRID: IMSR_JAX:028583 |
| Fah−/− | Grompe et al., 1993 | N/A |
| Oligonucleotides | ||
| Primers for Sry: Forward: CTCATCGGAGGGCTAAAGTG |
D’Hulst et al., 2013 | N/A |
| Primers for Sry: Forward: AAGCTTTGCTGGTTTTTGGA |
D’Hulst et al., 2013 | N/A |
| Primers for Fah: Forward: GGACTTCTACTCTTCTCGGCA |
This paper | N/A |
| Primers for Fah: Forward: CAATTTGGCAACAGCGCATTC |
This paper | N/A |
| Software and Algorithms | ||
| R | https://www.r-project.org/ | Version 3.4.3 |
| beeswarm | R | Version 0.2.3 |
| ggplot2 | R | Version 2.2.1 |
| ImageJ | https://imagej.nih.gov/ij/ | Version 1.52 |
| ZEN 2.3 (blue edition) | Zeiss | Version 2.3.69.1000 |
| Imaris | Bitplane | Version 9.2.1 |
| FlowJo | Becton-Dickenson | Version 10.6.0 |
| Other | ||
| Zeiss LSM 780 | Zeiss | N/A |
| Cytopeia inFluxV-GS | Becton-Dickenson | N/A |
| BD LSRFortessa | Becton-Dickenson | N/A |
| CytoFLEX S | Beckman Coulter | N/A |