KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-EB1 (Clone KT51), rat monoclonal | Abcam | Cat#ab53358 |
| Anti-GFP (Clone JL-8), mouse monoclonal | Takara Clontech | Cat#632381 |
| Anti-GM130 (Clone 35), mouse monoclonal | BD Pharmingen | Cat#610822, Cat#560257 |
| Anti-MBP, rat monoclonal | Abcam | Cat#ab7349 |
| Anti-MYO18A, rabbit polyclonal | Sigma | Cat#HPA021121 |
| Anti-TPPP, goat polyclonal (for IP, Western blot) | ThermoFisher Scientific | Cat#PA5–19243 |
| Anti-TPPP, rabbit polyclonal (for staining, immuno-EM) | Proteintech | Cat#18742–1-AP |
| Anti-α-tubulin (Clone YL1/2), rat monoclonal | ThermoFisher Scientific | Cat#MA1–80017 |
| Anti-α/β-tubulin, sheep polyclonal | Cytoskeleton | Cat#ATN02 |
| Anti-γ-tubulin (Clone DQ-19), rabbit polyclonal | Sigma | Cat#T3195 |
| Anti-γ-tubulin (Clone GTU-88), mouse monoclonal | Sigma | Cat#T5326 |
| Anti-γ-tubulin, rabbit polyclonal | Sigma | Cat#T3559 |
| Anti-γ-tubulin, rabbit polyclonal | Sigma | Cat#T5192 |
| Anti-γ-tubulin (Clone TU-30), mouse polyclonal | Santa Cruz | Cat#sc-51715 |
| Bacterial and Virus Strains | ||
| BL21 (DE3) E. coli | NEB | Cat#C2527I |
| Chemicals, Peptides, and Recombinant Proteins | ||
| His60 Ni-NTA resin | Takara Clontech | Cat#635659 |
| Streptactin or StreptactinXT affinity chromatography | IBA Lifesciences | Cat#2-4998-000 |
| Fractogel EMD SO3− (M) Resin | EMD Millipore | Cat#1168820010 |
| SiMAG-IDA/Nickel 1-μm Beads | Chemicell | Cat#1512–1 |
| Poly-D-lysine Hydrobromide | Sigma | Cat#P6407 |
| Hibernate A Low Fluorescence Media | BrainBits | Cat#HALF |
| Dynabeads Protein G for Immunoprecipitation | ThermoFisher Scientific | Cat#10004D |
| RapiGest SF Surfactant | Waters Corporation | Cat#186001861 |
| Sequencing Grade Modified Trypsin | Promega | Cat#V5113 |
| Porcine Tubulin (for oligodendrocyte lysate nucleation assay) | Cytoskeleton | Cat#T240-A |
| Rhodamine Porcine Tubulin (for oligodendrocyte lysate nucleation assay) | Cytoskeleton | Cat#TL590M-A |
| GMPCPP | Jena Bioscience | Cat#NU-405S |
| TAMRA; 5-(and-6)-Carboxytetramethylrhodamine, Succinimidyl Ester, mixed isomers | ThermoFisher Scientific | Cat#C1171 |
| ATTO 633 NHS-ester | ATTO-TEC | Cat#AD 633–31 |
| Experimental Models: Organisms/Strains | ||
| TPPP knockout mice | Knockout Mouse Project (KOMP) | Cat#VG12652 |
| Wildtype rats, Sprague-Dawley strain | Charles River | N/A |
| Oligonucleotides | ||
| smFISH probes against mouse Mbp mRNA CDS, (5’ to 3’): gaagctcgtcggactctgag, ctgtggggtcttcttggatg, gtacttggatcgctgtgagg, atggtccatggtacttgctg, ctgtcaccgctaaagaagcg, taatgggtagttctcgtgtg, gactactgggttttcatctt, ttgggatggaggtggtgttc, caggattcgggaaggctgag, ggcagttatattaagaagcc, actagctaatcggtgcaagt, cgggattaagagagggtctg, atagttttaaccagtcgggg, accccgagaaaactcaatct, ggaacaagtcagggctgaga, aacctccggagtcgaacaag, gtaggggtgaacttggaagg, aaacaaagctctttaggggg, agactgtctgatcctgttag, acaagcccccgttgtataag, acgctcgaaatcagctggtg, acacatatctccagcgtgtt, agagatggtgacatttggcg, cttaaaagcaccagctctgg, accatgagaagtggccagag, ttagtgtgtaccaatgggca, aatggttatttttccaccga, gagtcctttctaggaggcag, gaacccccctaaagctaaga, cagcgactcgattcagtgac, ggacattattagactggggt, agagggataaggaggtgtcg, acagaaggcatgctaaatca, agtgtggggctctttggaag, caagatgcagtattgggcta, ctctactcagagttagaaca, tcggtgttatcttaaaccca, cacgttattgtggcgataca, aaacactcccgtgggacaat, aaggtcgttcagtcacactg, gaatagtaggtgcttctgtc. | LGC Biosearch Technologies | Stellaris RNA Fish, Custom |
| Recombinant DNA | ||
| Plasmid: tdTomato-MannII-N-10 | Addgene | Cat#58110 |
| Plasmid: mCherry-EB3 | Gift from Erika Holzbaur | N/A |
| Plasmid: EB3-EGFP | Gift from Erika Holzbaur | N/A |
| cDNA: human EB3 (GenBank Accession AY893969) | Harvard PlasmID Database | Plasmid ID: HsCD00331591 |
| cDNA: human TPPP (GenBank Accession BC131506) | Harvard PlasmID Database | Plasmid ID: HsCD00347208 |
| cDNA: rat TPPP | NCBI Reference Sequence | NM_001108461 |
| Plasmid: pHAT2 | Addgene | Plasmid ID: 112583 |
| Plasmid: TPPP-mNeonGreen | This paper | N/A |
| Plasmid: pEGFP-C1 | Takara Clontech | Replaced with: Cat#632468 |
| Plasmid: TPPP-EGFP | This paper | N/A |
| Software and Algorithms | ||
| FIJI/ImageJ | (Schindelin et al., 2012) | Version 2.0.0-rc-69/1.52n; http://fiji.sc |
| Neurolucida 360 | MBF Bioscience | https://www.mbfbioscience.com/neurolucida360 |
| Neurolucida Explorer | MBF Bioscience | https://www.mbfbioscience.com/neurolucida-explorer |
| Photoshop CS6 | Adobe Systems | Version 13.0 ×64 |
| Prism | Graph Pad | Version 8 |
| SoftWoRx | GE Healthcare Life Sciences | DeltaVision Imaging System |
| Other | ||
| 12-well plate containing cell crown inserts of Mimetix aligned fibers (PLLA, 2-micron fiber diameter) | Electrospinning UK via Amsbio | Cat#TECL-006 |
| Tissue-Plus O.C.T. Compound | ThermoFisher Scientific | Cat#23-730-571 |
| VECTASHIELD Antifade Mounting Medium with DAPI | Vector Laboratories | Cat#H-1200 |
| ProLong Gold Antifade Mountant | ThermoFisher Scientific | Cat#P36934 |
| Precision Cover Glasses Thickness No. 1.5H (for super-resolution microscopy) | Marienfeld | Cat#0117520 |
| 35-mm Dish No. 1.5 Coverslip 14-mm Glass Diameter Poly-D-Lysine Coated | MatTek Corporation | Cat#P35GC-1.5–14-C |
| 300 Mesh Copper Grid with Formvar/Carbon Coating/Film | Electron Microscopy Sciences | Cat#FCF300-Cu |
| Goat Anti-Rabbit IgG 5-nm Gold Beads | BBI Solutions | Cat#EM.GAR5 |
| OMIX C18 Pipette Tips | Agilent Technologies | Cat#A570033100 |
| EasySpray C18 column (3-μm, 75 μm diameter × 150 mm length) | ThermoFisher Scientific | Cat#ES800A |