Table 1.
Primers used to amplify the five molecular regions of Culicoides specimens
| Gene | Primer name | Sequence 5′–3′ | Fragment length (bp) | Reference |
|---|---|---|---|---|
| cox1 | C1J1718 | GGAGGATTTGGAAATTGATTAGT | 523 | Dallas et al. [38] |
| C1N2191 | CAGGTAAAATTAAAATATAAACTTCTGG | Dallas et al. [38] | ||
| cox2 | COIIF20 | ATGGCAACTTGAGGAMATAT | 601 | This study |
| COIIR612 | CGCAGATTTCTGAACATTG | This study | ||
| cytb | CytbF373 | ATAGGAACTGCTTTTATAGG | 526 | This study |
| CytbR944 | CAATAGATATGACTAAAGCGATTACT | This study | ||
| ITS1-5.8S-ITS2 | PanCulF | GTAGGTGAACCTGCGGAAGG | ~785 | Cêtre-Sossah et al. [67] |
| 28SR | ATTTGGGGGTAGTCACACAT | Gomulski et al. [40] |
Note: The 3 regions ITS1-58S-ITS2 were amplified together
Abbreviations: cox1, cytochrome c oxidase subunit 1; cox2, cytochrome c oxidase 2; cytb for cytochrome b; ITS1-58S-ITS2, internal transcribed spacer 1-5.8S-internal transcribed spacer 2