TABLE 1.
Strains, plasmids and primers used in this study.
| Strain, plasmid and primer | Relevant characteristics and/or plasmid construction* | Usage | Source |
| Bacteria | |||
| E. coli | |||
| JM109 | F′ [traD36 proAB+lacIqlacZΔM15]/recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi-1 mcrA (lac-proAB) | Gene cloning | Promega |
| S17-1 | hsdR17 (rK- mK-) recA RP4-2 (Tcr:Mu-Kmr:Tn7 Strr) | Conjugation | Chen et al., 2010b |
| TransforMax EC100 + | F-mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ-rpsL (Strr) nupG | Recovering the transposon | Epicenter |
| E. anophelis | |||
| Ag1 | WT, isolated from mosquito A. gambiae | RNAseq and genetic analysis | Kukutla et al., 2014 |
| SCH814 | Reporter strain; Kmr(Emr) | Luciferase labeled strain | Chen et al., 2015 |
| SCH908 | Reporter strain for Elilysin2 gene; Kmr(Emr) | Luciferase labeled strain for hemolysin gene expression assay | This study |
| SCH1065 | ΔiucA_iucC/iucB/iucD | Siderophore synthesis mutant | This study |
| Plasmids | |||
| pYT313 | Suicide vector with Ampr(Emr) | Deletion vector for E. anophelis | Zhu et al., 2017 |
| pSCH893 | T-easy vector carrying the promoter of hemolysin gene; Ampr | Cloning upstream gene fragment of hemolysin gene | This study |
| pSCH801 | Transposon with the luciferase reporter; Kmr(Emr) | Transposon for delivering reporter gene in E. anophelis | Chen et al., 2015 |
| pSCH905 | Reporter gene fused with hemolysin gene promoter | Reporter plasmid | This study |
| pSCH1038 | Upstream fragment of siderophore synthesis gene cluster on T-easy vector; Ampr | Cloning | This study |
| pSCH1033 | Downstream fragment of siderophore synthesis gene cluster on T-easy vector; Ampr | Cloning | This study |
| pSCH1034 | Suicide vector for deletion of iucA_iucC/iucB/iucD; Ampr(Emr) | Gene knockout | This study |
| Primers | |||
| Walker183 | ACCCGGG TGTTCTTAAGACTTTTGAAGCAGG | Hemolysin promoter forward primer amplification | |
| Walker185 | AGGATCC TAGTTGTTAGAACTGCTTTTGTAGAAGC | Hemolysin promoter reverse primer amplification | |
| Walker277 | GGATCCTGCAGCCTCATCTATGTTCTGG | Upstream fragment amplification for deletion of siderophore genes | |
| Walker278 | GTCGACCCTGAATCGGAAACCTTCTGTGCC | Upstream fragment amplification for deletion of siderophore genes | |
| Walker285 | GTCGACCCTATATCTTTACCGATGTATTCGATTG | Downstream fragment amplification for deletion of siderophore genes | |
| Walker 287 | GCATGCGATATAATCCTGGCAGAATTCCGGTC | Downstream fragment amplification for deletion of siderophore genes | |
| Walker297 | CTATTACCAGCAAACAGTACAAGAC | Forward primer for iucA for confirmation of gene loss | |
| Walker298 | CTTTACCAAGTCCCAGTATGCTGG | Reverse primer for iucA confirmation of gene loss | |
| Walker299 | CCGCCAGGTTTTCCTGAAGAC | Forward primer for iucB for confirmation of gene loss | |
| Walker300 | TTCTATTGCCCACTGACAATAC | Reverse primer for iucB confirmation of gene loss | |
| Walker301 | GATGTGCATTCAATAAGAAAGAC | Forward primer for iucC for confirmation of gene loss | |
| Walker302 | CCACCCACTGATTAATAGCC | Reverse primer for iucC confirmation of gene loss | |
| Walker295 | CTTACAGCAGAACATACTCCGG | Forward primer for screening mutants | |
| Walker296 | CAACTCTTGGGGGTTGTTATCC | Reverse primer for screening mutants | |
*Antibiotic resistance phenotype: Ampr, ampicillin resistance; Kmr, kanamycin resistance; Emr, erythromycin resistance. Unless indicated otherwise, antibiotic resistance phenotypes are those expressed in E. coli. Antibiotic resistance phenotypes in parentheses are those expressed in E. anophelis strains but not in E. coli.