Skip to main content
. 2020 Apr 24;9:e52714. doi: 10.7554/eLife.52714

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional
information
Gene (Rat or Mouse) -HRI
-HRI-opt
-ZsGreen
GeneScript
Clone ID: OMu18622C
Entrez Gene: NM_013557.2
Strain, strain background (Escherichia coli) BL21 (DE3) Sigma-Aldrich CMC0016 Electrocompetent cells
Genetic reagent (Rat or Mouse) -Primary Neurons Other Animals obtained from our animal house
Cell line (Human) -HeLa (RRID:CVCL_0030) -ATCC
Transfected construct (mouse, Rat) -HA-HRI
-HRI-HA
-HRI-HA-opt
-ZsGreen
-ZsGreen-HRI-HA
-Ubiquitin K48R
This paper Constructs used to over-express HRI or ubiquitin genes in primary neurons.
The constructs of HRI with the different tags can be obtained from Erin Schuman’s Laboratory (MPI-BR)
Biological sample (Mouse) -Blood (mouse wt and HRI K.O)
-Liver (mouse wt and HRI K.O)
-Brain (mouse wt and HRI K.O)
DOI:
10.1093/emboj/20.23.6909
Antibody -Rabbit polyclonal anti-peIF2α Invitrogen 44728G
RRID:AB_1500038
(1:1000) WB
Antibody -Mouse monoclonal eIF2α Cell signalling 2103 (1:1000) WB
Antibody -Rabbit polyclonal peIF4B Cell signalling 5399 (1:2000) WB
Antibody -Rabbit Monoclonal p4EBP1 Cell signalling 2855
RRID:AB_560835
(1:1000) WB
Antibody -Rabbit polyclonal peIF4G Cell signalling 2441 (1:25000) WB
Antibody -Rabbit polyclonal HRI Millipore 07–728
RRID:AB_441964
(1:1000) WB
Aantibody -Rabbit polyclonal anti-actin abcam Ab8227
RRID:AB_2305186
(1:5000) WB
Antibody -Rabbit polyclonal anti-H3 Abcam AB18521
RRID:AB_732917
(1:10000) WB
Antibody -Rabbit polyclonal anti-biotin SIGMA 31852 (1:10000) WB
Antibody -Mouse monoclonal anti-puromycin Kerafast 3RH11 (WB, 1:1000, IF 1:3500)
Antibody -Guinea pig polyclonal anti-MAP2 Synaptic Systems 188004 (IF 1:1000)
Antibody -Rabbit polyclonal anti- HA-tag Rockland 600-401-384 (IF 1:2000)
Antibody -Goat polyclonal anti-mouse or anti-rabbit IR680 or IR800 Licor -Goat anti-mouse or anti-rabbit IR680 or IR800 (WB 1:5.000,)
Antibody -Goat polyclonal anti-guinea pig Dylight405 Dianova 106-475-008
RRID:AB_2337434
(IF 1:1000)
Antibody -Goat polyclonal anti-guinea pig-Alexa488 Dianova 106-546-003
RRID:AB_2337441
(IF 1:1000)
Antibody -Alexa488, polyclonal goat anti-rabbit Alexa647 or -Alexa546 ThermoFisher R37116, A32733, A-21085 (IF all 1:1000)
Peptide, recombinant protein -eIF2a
-HRI
Abcam ab95932
ab131665
Peptide, recombinant protein −20S proteasome Enzo BML-PW8720-0050
Commercial assay or kit -Free heme measurement kit Sigma MAK316
Chemical compound, drug -Puromycin
-Doxycycline (Doxo)
-MG132
-Lactacystin
−7-Nitroindazole (7-NA)
-S-methyl-L-thiocitrulline (L-SMTC)
-N-acetyl-cysteine (NAC)
-Ascorbic Acid (AA)
-MitoTempo
-Trolox
-Actinomycin-D (ActD)
-FePPIX (hemin)
-CoPPIX
Sigma -Puromycin (P8833)
-Doxycycline (D9891)
-MG132 (M8699)
-Lactacystin (L6785)
−7-Nitroindazole (N7778)
-S-methyl-L-thiocitrulline (M5171)
-N-acetyl-cysteine (A9165)
-Ascorbic Acid (A1968)
-MitoTempo (SML0737)
-Trolox (648471)
-Actinomycin-D (A1410)
-FePPIX (hemin) (H9039)
-CoPPIX (C1900)
Chemical compound, drug -SnMPIX
-ZnPPIX
-NG mono methyl L-Arginine (L-NMMA)
-The PKR inhibitor
Cayman -SnMPIX (19071)
-ZnPPIX (14483)
-L-NMMA (10005031)
-The PKR inhibitor (15323)
Genetic reagent (Mus musculus) -PERK K.O.
-GCN2 K.O.
Jackson -PERK K.O. (line #009340)
RRID:IMSR_JAX:009340
-GCN2 K.O. (line #008240)
RRID:IMSR_JAX:008240
Genetic reagent (Mus musculus) -HRI K.O.
Obtained from the laboratory of Dr, Jane Chen
(Harvard-MIT)
PMID:11726526 (Han et al., 2001)
Software, algorithm https://github.molgen.mpg.de/MPIBR-Bioinformatics/CodonUsage https://github.molgen.mpg.de/MPIBR-Bioinformatics/CodonUsage The kinase gene list was generated by a keyword search in gene description. Analysis and plotting scripts can be found in this repository
Sequence-based reagent HRI Taqman Assay IDT Rn.PT.58.5930825 Used for ddPCR
Sequence-based reagent Rn18s rRNA 18 s Taqman Assay Thermo-fisher Mm0427757_s1 Used for ddPCR
Sequence-based reagent Actin beta Taqman Assay IDT Rn.PT.39a.22214838.g Used for ddPCR
Sequence-based reagent Atf4 Taqman Assay IDT Rn.PT.58.13690870.g Used for ddPCR
Sequence-based reagent HRI-HA IDT PCR primer one for
HRI-hemagglutinin tag
Used for ddPCR
CAGCTACTGCAGAGCGAACT
Sequence-based reagent HRI-HA IDT PCR primer two for
HRI-hemagglutinin tag
Used for ddPCR
GCGTAATCTGGAACATCGTATGG
Sequence-based reagent HRI-HA IDT Probe Used for ddPCR
/56-FAM/AGCCTCCTT/ZEN/TCGCAGGACAAAGGGCTG/3IABkFQ/
Sequence-based reagent HRI-HA-opt IDT PCR primer 1 HRI-hemagglutinin tag optimized Used for ddPCR
TCCAGAGCGAGCTGTTCCAG
Sequence-based reagent HRI-HA-opt IDT PCR primer 2 HRI-hemagglutinin tag optimized Used for ddPCR
GCATAGTCAGGCACATCATAAGGG
Sequence-based reagent HRI-HA-opt IDT Probe
HRI-hemagglutinin tag optimized
Used for ddPCR
/56-FAM/ACCACCGGC/ZEN/AACGTGAACCTGACCC/3IABkFQ/