Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|
|---|---|---|---|---|---|
| Gene (Rat or Mouse) | -HRI -HRI-opt -ZsGreen |
GeneScript Clone ID: OMu18622C |
Entrez Gene: NM_013557.2 | ||
| Strain, strain background (Escherichia coli) | BL21 (DE3) | Sigma-Aldrich | CMC0016 | Electrocompetent cells | |
| Genetic reagent (Rat or Mouse) | -Primary Neurons | Other | Animals obtained from our animal house | ||
| Cell line (Human) | -HeLa (RRID:CVCL_0030) | -ATCC | |||
| Transfected construct (mouse, Rat) | -HA-HRI -HRI-HA -HRI-HA-opt -ZsGreen -ZsGreen-HRI-HA -Ubiquitin K48R |
This paper | Constructs used to over-express HRI or ubiquitin genes in primary neurons. The constructs of HRI with the different tags can be obtained from Erin Schuman’s Laboratory (MPI-BR) |
||
| Biological sample (Mouse) | -Blood (mouse wt and HRI K.O) -Liver (mouse wt and HRI K.O) -Brain (mouse wt and HRI K.O) |
DOI: 10.1093/emboj/20.23.6909 |
|||
| Antibody | -Rabbit polyclonal anti-peIF2α | Invitrogen | 44728G RRID:AB_1500038 |
(1:1000) WB | |
| Antibody | -Mouse monoclonal eIF2α | Cell signalling | 2103 | (1:1000) WB | |
| Antibody | -Rabbit polyclonal peIF4B | Cell signalling | 5399 | (1:2000) WB | |
| Antibody | -Rabbit Monoclonal p4EBP1 | Cell signalling | 2855 RRID:AB_560835 |
(1:1000) WB | |
| Antibody | -Rabbit polyclonal peIF4G | Cell signalling | 2441 | (1:25000) WB | |
| Antibody | -Rabbit polyclonal HRI | Millipore | 07–728 RRID:AB_441964 |
(1:1000) WB | |
| Aantibody | -Rabbit polyclonal anti-actin | abcam | Ab8227 RRID:AB_2305186 |
(1:5000) WB | |
| Antibody | -Rabbit polyclonal anti-H3 | Abcam | AB18521 RRID:AB_732917 |
(1:10000) WB | |
| Antibody | -Rabbit polyclonal anti-biotin | SIGMA | 31852 | (1:10000) WB | |
| Antibody | -Mouse monoclonal anti-puromycin | Kerafast | 3RH11 | (WB, 1:1000, IF 1:3500) | |
| Antibody | -Guinea pig polyclonal anti-MAP2 | Synaptic Systems | 188004 | (IF 1:1000) | |
| Antibody | -Rabbit polyclonal anti- HA-tag | Rockland | 600-401-384 | (IF 1:2000) | |
| Antibody | -Goat polyclonal anti-mouse or anti-rabbit IR680 or IR800 | Licor | -Goat anti-mouse or anti-rabbit IR680 or IR800 | (WB 1:5.000,) | |
| Antibody | -Goat polyclonal anti-guinea pig Dylight405 | Dianova | 106-475-008 RRID:AB_2337434 |
(IF 1:1000) | |
| Antibody | -Goat polyclonal anti-guinea pig-Alexa488 | Dianova | 106-546-003 RRID:AB_2337441 |
(IF 1:1000) | |
| Antibody | -Alexa488, polyclonal goat anti-rabbit Alexa647 or -Alexa546 | ThermoFisher | R37116, A32733, A-21085 | (IF all 1:1000) | |
| Peptide, recombinant protein | -eIF2a -HRI |
Abcam | ab95932 ab131665 |
||
| Peptide, recombinant protein | −20S proteasome | Enzo | BML-PW8720-0050 | ||
| Commercial assay or kit | -Free heme measurement kit | Sigma | MAK316 | ||
| Chemical compound, drug | -Puromycin -Doxycycline (Doxo) -MG132 -Lactacystin −7-Nitroindazole (7-NA) -S-methyl-L-thiocitrulline (L-SMTC) -N-acetyl-cysteine (NAC) -Ascorbic Acid (AA) -MitoTempo -Trolox -Actinomycin-D (ActD) -FePPIX (hemin) -CoPPIX |
Sigma | -Puromycin (P8833) -Doxycycline (D9891) -MG132 (M8699) -Lactacystin (L6785) −7-Nitroindazole (N7778) -S-methyl-L-thiocitrulline (M5171) -N-acetyl-cysteine (A9165) -Ascorbic Acid (A1968) -MitoTempo (SML0737) -Trolox (648471) -Actinomycin-D (A1410) -FePPIX (hemin) (H9039) -CoPPIX (C1900) |
||
| Chemical compound, drug | -SnMPIX -ZnPPIX -NG mono methyl L-Arginine (L-NMMA) -The PKR inhibitor |
Cayman | -SnMPIX (19071) -ZnPPIX (14483) -L-NMMA (10005031) -The PKR inhibitor (15323) |
||
| Genetic reagent (Mus musculus) | -PERK K.O. -GCN2 K.O. |
Jackson | -PERK K.O. (line #009340) RRID:IMSR_JAX:009340 -GCN2 K.O. (line #008240) RRID:IMSR_JAX:008240 |
||
| Genetic reagent (Mus musculus) | -HRI K.O. Obtained from the laboratory of Dr, Jane Chen (Harvard-MIT) |
PMID:11726526 (Han et al., 2001) | |||
| Software, algorithm | https://github.molgen.mpg.de/MPIBR-Bioinformatics/CodonUsage | https://github.molgen.mpg.de/MPIBR-Bioinformatics/CodonUsage | The kinase gene list was generated by a keyword search in gene description. Analysis and plotting scripts can be found in this repository | ||
| Sequence-based reagent | HRI Taqman Assay | IDT | Rn.PT.58.5930825 | Used for ddPCR | |
| Sequence-based reagent | Rn18s rRNA 18 s Taqman Assay | Thermo-fisher | Mm0427757_s1 | Used for ddPCR | |
| Sequence-based reagent | Actin beta Taqman Assay | IDT | Rn.PT.39a.22214838.g | Used for ddPCR | |
| Sequence-based reagent | Atf4 Taqman Assay | IDT | Rn.PT.58.13690870.g | Used for ddPCR | |
| Sequence-based reagent | HRI-HA | IDT | PCR primer one for HRI-hemagglutinin tag |
Used for ddPCR CAGCTACTGCAGAGCGAACT |
|
| Sequence-based reagent | HRI-HA | IDT | PCR primer two for HRI-hemagglutinin tag |
Used for ddPCR GCGTAATCTGGAACATCGTATGG |
|
| Sequence-based reagent | HRI-HA | IDT | Probe | Used for ddPCR /56-FAM/AGCCTCCTT/ZEN/TCGCAGGACAAAGGGCTG/3IABkFQ/ |
|
| Sequence-based reagent | HRI-HA-opt | IDT | PCR primer 1 HRI-hemagglutinin tag optimized | Used for ddPCR TCCAGAGCGAGCTGTTCCAG |
|
| Sequence-based reagent | HRI-HA-opt | IDT | PCR primer 2 HRI-hemagglutinin tag optimized | Used for ddPCR GCATAGTCAGGCACATCATAAGGG |
|
| Sequence-based reagent | HRI-HA-opt | IDT | Probe HRI-hemagglutinin tag optimized |
Used for ddPCR /56-FAM/ACCACCGGC/ZEN/AACGTGAACCTGACCC/3IABkFQ/ |
|