Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rabbit Polyclonal CD19 antibody | Cell Signaling | Cat#3574S; RRID:AB_2275523 | 1:500 (western blot) |
| Antibody | CD19 Mouse Monoclonal Antibody (SJ25-C1), Alexa Fluor 488 | Thermo-Fisher | Cat#MHCD1920; RRID:AB_389313 | 2 µg/mL (flow cytometry) |
| Antibody | GAPDH (D16H11) Rabbit Monoclonal Antibody (HRP Conjugate) | Cell Signaling | Cat#8884S; RRID:AB_11129865 | 1:10,000 (western blot) |
| Antibody | APC Mouse Monoclonal anti-human CD81 | BioLegend | Cat#349510; RRID:AB_2564020 | 2 µg/mL (flow cytometry) |
| Antibody | Human Monoclonal CD81 Clone Ab5 | Recombinant; Nelson et al., 2018 | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD81 Clone Ab10 | Recombinant; Nelson et al., 2018 | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD81 Clone Ab21 | Recombinant; Nelson et al., 2018 | 2 µg/mL (flow cytometry) 1:1000 (western blot) | |
| Antibody | Human Monoclonal CD81 Clone 5A6 | Recombinant; WO 2017/218691 A1 | 2 µg/mL (flow cytometry) 1:100 (western blot) | |
| Antibody | Human Monoclonal CD19 (Coltuximab) |
Recombinant; Therapeutic Antibody Database | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD19 (Denintuzumab) | Recombinant; Therapeutic Antibody Database | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD19 (Inebiliziumab) | Recombinant; Therapeutic Antibody Database | 2 µg/mL (flow cytometry) | |
| Antibody | APC Mouse Monoclonal CD86 antibody | BioLegend | Cat#374208; RRID:AB_2721449 | 2 µg/mL (flow cytometry) |
| Antibody | APC Mouse Monoclonal CD20 Clone L27 | BD Biosciences | Cat#340941; RRID:AB_1645724 | 1 µg/mL (flow cytometry) |
| Antibody | Donkey anti-Rabbit IgG (H+L) HRP Conjugate | Sigma Aldrich | Cat#GENA934-1ML; RRID:AB_2722659 | 1:5000 (western blot) |
| Antibody | Rabbit Anti-Human IgG H and L HRP Conjugate | Abcam | Cat#ab6759; RRID_:AB_955434 | 1:5000 (western blot) |
| Antibody | F(ab')2-Goat anti-Human IgG, IgM (H+L), Functional Grade | Thermo-Fisher | Cat#16-5099-85 | 20 µg/mL (B cell activation) |
| Biological sample (human) | Leuko-reduction Collar | Brigham and Women’s Hospital Crimson Core | ||
| Commercial assay or kit | QuickExtract DNA Extraction Solution | VWR | Cat#76081–766 | |
| Chemical compound | Valproic Acid Sodium Salt | Sigma Aldrich | Cat#P4543-25G | |
| Chemical compound, drug | D-(+)-Glucose solution | Sigma Aldrich | Cat#G8769-100ML | |
| Chemical compound, drug | Magnesium Formate DiHydrate | Hampton Research | Cat#HR2-537 | |
| Chemical compound, drug | StockOptions Sodium Acetate | Hampton Research | Cat#HR2-933-01 | |
| Chemical compound, drug | Polyethylene Glycol Monomethyl Ether 550 | Hampton Research | Cat#HR2-611 | |
| Other | MicroTools | Hampton Research | Cat#HR4-837 | |
| Commercial assay or kit | RosetteSep Human B Cell Enrichment Cocktail | STEMCELL Technologies | Cat#15024 | |
| Commercial assay or kit | Lymphoprep density gradient medium | STEMCELL Technologies | Cat#07851 | |
| Chemical compound, drug | Nutridoma-SP | Sigma Aldrich | Cat#11011375001 | |
| Chemical compound, drug | n-Dodecyl-B-D-maltoside (DDM) | Anatrace | Cat#D310 | |
| Chemical compound, drug | Cholesteryl Hemisuccinate | Sigma Aldrich | Cat#C6512 | |
| Chemical compound, drug | Iodoacetamide | Sigma Aldrich | Cat# I1149-5G | |
| Peptide, recombinant protein | Benzonase nuclease | Sigma Aldrich | Cat# E1014-25KU | |
| Commercial assay or kit | In-Fusion HD Cloning Plus | Clontech | Cat# 638911 | |
| Cell line (human) | Expi293F Cells | Thermo-Fisher | Cat#A14527 | |
| Cell line (human) | CD81 null HEK293T cells | This paper | HEK293T cells with CD81 knocked out using CRISPR/Cas9 | |
| Sequence-based reagent | gRNA forward primer for CD81 knockout cell line generation | Integrated DNA Technologies | CACCGATGCGCTGCGTCTGCGGCG | |
| Sequence-based reagent | gRNA reverse primer for CD81 knockout cell line generation | Integrated DNA Technologies | AAACCGCCGCAGACGCAGCGCATC | |
| Recombinant DNA reagent | pcDNA3.1 (+) Mammalian Expression Vector | Thermo-Fisher | Cat#V79020 | |
| Recombinant DNA reagent | pFUSE-hIgG1-Fc2 | InvivoGen | Cat#pfuse-hg1fc2 | |
| Recombinant DNA reagent | pD2610-v5 CMV(v5)-ORF Mamm-ElecD | ATUM | N/A | |
| Recombinant DNA reagent | gBlocks | Integrated DNA Technologies | N/A | |
| Recombinant DNA reagent | pSpCas9(BB)−2A-GFP (PX458) | Addgene | Cat#48138 | |
| Software, algorithm | GraphPad Prism 8.0 | N/A | http://www.graphpad.com/scientific-software/prism/ | |
| Software, algorithm | BD Accuri C6 Plus software | BD Accuri C6 Plus | http://www.bdbiosciences.com/en-us/instruments/research-instruments/research-cell-analyzers/accuri-c6-plus | |
| Software, algorithm | SB Grid Consortium | Morin et al., 2013 | https://sbgrid.org/software/ | |
| Software, algorithm | XDS | Kabsch, 2010 | https://sbgrid.org/software/ | |
| Software, algorithm | Phenix | Afonine et al., 2012 | https://sbgrid.org/software/ | |
| Software, algorithm | Coot | Emsley and Cowtan, 2004 | https://sbgrid.org/software/ | |
| Software, algorithm | PyMOL | DeLano, 2010 | https://sbgrid.org/software/ |