Table 3.
Summary of the bookmark sequences. Nine protospacers were picked from the literature as successful examples of SpCas9 targets in bacterial species [17,18,19]. To constitute a bookmark, each protospacer should be immediately followed by a PAM (suggested: AGG) and complemented with one single nucleotide at either extremity. For each bookmark, the position of the extra nucleotide as well as the orientation of the bookmark relative to the coding sequence (CDS) it replaces are given to avoid internal STOP codons. “+”: same direction as the target CDS, “ – ”: reverse-complementary direction relative to the target CDS, “+/−”: either same or reverse-complementary direction relative to the target CDS, S. pneumonia: Streptococcus pneumonia, B. subtilis: Bacillus subtilis, L. reuteri = Lactobacillus reuteri.
| Bookmark | Bookmark Sequence (24 nt) | Orientation | Origin | |||
|---|---|---|---|---|---|---|
| Extra nt | Protospacer (20 nt) | PAM | Extra nt | |||
| BM4 | G | AGGGTTGTGGGTTGTACGGA | AGG | / | +/− | S. pneumonia |
| BM5 | / | ATTTCTGATATTACTGTCAC | AGG | A | +/− | S. pneumoniae |
| BM6 | / | ACCGATACCGTTTACGAAAT | AGG | A | +/− | S. pneumoniae |
| BM7 | G | TGAAGATCAGGCTATCACTG | AGG | / | + | B. subtilis |
| BM8 | G | TCCGGAGCTCCGATAAAAAA | TGG | / | +/− | B. subtilis |
| BM9 | G | TATTGATTCTCTTCAAGTAG | AGG | / | − | B. subtilis |
| BM10 | / | CCATTGTACTATCATGCTAG | AGG | A | +/− | L. reuteri |
| BM11 | G | ATGCAGTCGGCTGTAGAAAG | AGG | / | +/− | L. reuteri |
| BM12 | G | CGACTGCATTTTATTATGTA | AGG | / | +/− | L. reuteri |