Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Predictions of nbe-miR1919c-5p targeted N. benthamiana genes.
| miRNA | Target Gene | Expectation | UPE | miRNA Start | miRNA End | Target Start | Target End | miRNA Aligned Fragment | Target Aligned Fragment | Inhibition | Multiplicity |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Nbe-miR1919c-5p | Niben101Scf04663g00007 | 2.0 | 15.475 | 1 | 21 | 254 | 274 | UGUCGCAGAUGACUUUCGCCC | AUGCGAAAGUCAUCUGCGACA | Cleavage | 1 |
| Nbe-miR1919c-5p | Niben101Scf02655g01001 | 2.0 | 16.74 | 1 | 21 | 485 | 505 | UGUCGCAGAUGACUUUCGCCC | AUGCGAAAGUCAUCUGCGACA | Cleavage | 1 |
