Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for integrin β6 promoter reporter construction
| Construct | Primer | Sequence (5’-3’) |
| pGL4-B1 (-921/+208) | Sense -921 | GGGGTACCCACAGGCATTGACCTG |
| pGL4-B2 (-755/+208) | Sense -755 | GGGGTACTGACACCGATTGTCGAT |
| pGL4-B3 (-513/+208) | Sense -513 | GGGGTAGACTGACTGCCATTGAGGTGAT |
| pGL4-B4 (-350/+208) | Sense -350 | GGGGTCCCCACGGATTCCGTAGACCTC |
| pGL4-B5 (-85/+208) | Sense -85 | GGGGTAGGTACAGGAACCGACCTA |
| Antisense | GGGGTCCCGACATTCGATTGTCGCCTT |
