Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Gallus gallus) | GRCg6a | International Chicken Genome Consortium | GCF_000002315.5 | |
| Transfected construct | Modified px330: P18/MG18 |
Modified from the Cong et al., 2013 version | The original promoter of the px330 upstream of the Cas9 ORF was replaced with the CAG promoter | |
| Transfected construct | Modified px330 with OTX2 g2: MG10 | Lab made | ||
| Transfected construct | Modified px330 with OTX2 g3: MG233 | Lab made | ||
| Transfected construct | Modified Stagia3: ME1860 |
Emerson and Cepko, 2011 | Mouse OTX2 ECR2 EGFP reporter as described in Emerson and Cepko (2011) | |
| Transfected construct | CAG::βGal | Cepko lab | Expression vector, nuclear βGalactosidase reporter driven by the CAG promoter | |
| Transfected construct | CAG::EGFP | Matsuda and Cepko, 2004 | RRID:Addgene_11150 | Expression vector, EGFP reporter driven by the CAG promoter |
| Transfected construct | CAG::iRFP | Buenaventura et al., 2018 | Expression vector, iRFP reporter driven by the CAG promoter | |
| Antibody | Anti-OTX2 Goat polyclonal |
AF1979 | RRID:AB_1617988 | |
| Antibody | Anti- OTX1+OTX2 Rabbit polyclonal |
ab21990 | RRID:AB_776930 | |
| Antibody | Anti-PAX6 Mouse IgG1 monoclonal |
PAX6 | RRID:AB_528427 | |
| Antibody | Anti-BRN3A Mouse IgG1 monoclonal |
Mab1585 | RRID:AB_94166 | |
| Antibody | Anti-panBRN3 Mouse IgG1 monoclonal |
sc-390780 | ||
| Antibody | Anti-LIM1 Mouse IgG1 monoclonal | 4F2-C | RRID:AB_531784 | |
| Antibody | Anti-ISL1 Mouse monoclonal |
39.3F7 | RRID:AB_1157901 | |
| Antibody | Anti-PH3 Rabbit polyclonal |
06–570 | RRID:AB_10582726 | |
| Antibody | Anti-VSX2 Sheep polyclonal |
x1180p | RRID:AB_2314191 | |
| Antibody | Anti-βGAL Chick polyclonal |
ab37382 | RRID:AB_307210 | |
| Commercial assay | Click-iT EdU Alexa Fluor 647 imaging kit | Invitrogen | Cat#C10340 | |
| Reagent | O. C. T. Compound | Sakura Tissue-Tek | Cat#4583 | |
| Reagent | Fluoromount-G | Southern Biotech | Cat#0100–01 | |
| Reagent | Papain | Worthington | Cat#L5003126 | |
| Other | Raw matrix files | NCBI Gene Expression Omnibus | GEO: GSE142244 | |
| Software, algorithm |
SnapGene | GSL Biotech; snapgene.com | ||
| Software, algorithm | Fiji | Schneider et al. (2012) | https://fiji.sc/ | |
| Software, algorithm | Affinity Designer | Affinity software | ||
| Software, algorithm | JASP 0.9.0.1 | |||
| Software, algorithm | GraphPad Prism | GraphPad software | https://www.graphpad.com/scientific-software/prism/ | |
| Software, algorithm | R | R Core Team | https://www.r-project.org/ | |
| Software, algorithm | Seurat | Macosko et al. (2015) | http://satijalab.org/seurat/ | |
| Software, algorithm | ChopChop | Montague et al. (2014); Labun et al. (2016) | https://www.chopchop.cbu.uib.no | |
| Software, algorithm | FlowJo 10.2 | https://www.flowjo.com | ||
| Sequence-based reagent | Sex det. forward | This paper | PCR primers | CCCAAATATAACACGCTTCACT |
| Sequence-based reagent | Sex det. reverse | This paper | PCR primers | GAAATGAATTATTTTCTGGCGAC |
| Sequence-based reagent | Sex det. Control region forward |
This paper | PCR primers | AGCTCTTTCTCGATTCCGTG |
| Sequence-based reagent | Sex det. Control region reverse |
This paper | PCR primers | GGGTAGACACAAGCTGAGCC |
| Sequence-based reagent | Amplicon sequencing forward | This paper | PCR primers |
GGAGCGCACCACCTTCAC
|
| Sequence-based reagent | Amplicon sequencing reverse | This paper | PCR primers |
CTGCACTCTGGACTCGGGCTGCACTCTGGACTCGGG
|