Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Key primers used in this study
| Primer | Sequence 5′-3′ | Purpose |
|---|---|---|
| BBP950 | GAGCACACCCATCACGGTCAGAG | nifLA modification confirmation |
| BBP1322 | GATCTCCATCGACTCGATCTTGTCCAGGGTGAAC | nifLA modification confirmation |
| BBP2006 | CACGTGCCAGGAATTCCTCCATG | amtB gene deletion confirmation |
| BBP2007 | CTGTGGACGATGGCCAGGGACATGGATC | amtB gene deletion confirmation |
