. 2020 May 22;2(1):8. doi: 10.1186/s41544-020-00049-y

Table 1.

Sequence and reason of selection of the differentially expressed miRNAs used for validation

SN	miRNA	miRNA primer name	Primer Sequence (5′-3′)	Comments on the specific miRNA^a
1	bta-miR-9-5p	BbuMir16-F	ucuuugguuaucuagcug	To compare Br-Mu with Ctrl-Mu
2	bta-miR-677	BbuMir19-F	cucacugaugagcagcuu	To compare Br-Mu with Ctrl-Mu
3	bta-miR-331-3p	BbuMir18-F	gccccugggccuauccua	To compare JD-Mu with Ctrl-Mu
4	bta-miR-2440	BbuMir21-F	ugcagugaugagacccug	To compare JD-Mu with Ctrl-Mu
5	Endogenous Control	BbuRNU6	acgcaaauucgugaagcguu

^aBr-Mu: Brucella infected buffaloes of Murrah breed

JD-Mu: Johne’s Disease infected buffaloes of Murrah breed

Ctrl-Mu: Healthy buffaloes of Murrah breed