Skip to main content
. 2020 May 14;181(4):784–799.e19. doi: 10.1016/j.cell.2020.03.037
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Rabbit polyclonal anti-AQP4 antibody Abcam Cat#:ab46182; RRID: AB_955676
Mouse monoclonal anti-AQP4 antibody Abcam Cat#:ab9512; RRID: AB_307299
Rabbit anti-AQP4 antibody Abcam Cat#:ab128906; RRID: AB_11143780
Chicken anti-mouse IgG-HRP antibody Santa Cruz Cat#:sc-2954; RRID: AB_639239
Donkey anti-rabbit IgG-HRP antibody Santa Cruz Cat#:sc-2313; RRID: AB_641181
Rabbit anti-Foxo3 IgG antibody Abcam Cat#:ab23683; RRID: AB_732424
Mouse anti-RECA-1 antibody Abcam Cat#:ab9774; RRID: AB_296613
Goat anti-rabbit IgG FITC antibody Merck Cat#:F0382; RRID: AB_259384
Goat anti-chicken IgY Alexafluor 488 antibody Abcam Cat#:ab150169; RRID: AB_2636803
Goat anti-mouse IgG Alexafluor 633 antibody ThermoFisher Cat#:A-21050; RRID: AB_141431
Chicken anti-albumin antibody Abcam Cat#:ab106582; RRID: AB_10888110
Rabbit polyclonal anti-laminin antibody Sigma Cat#:L9393; RRID: AB_477163
Mouse anti β-actin antibody Sigma-Aldrich Cat#:A2228; RRID: AB_476697
Rabbit anti-calmodulin antibody Cell Signaling Cat#:D1F7J; RRID: AB_2799090
Rabbit anti-lamin B1 antibody Cell Signaling Cat#:D4Q4Z; RRID: AB_2650517
Rabbit anti-alpha tubulin antibody Cell Signaling Cat#:2144; RRID: AB_2210548
Mouse anti-His tag antibody Takara Bio Cat#:631212; RRID: AB_2721905

Bacterial and Virus Strains

E.coli strain DH5α Thermo Fisher 18265017
One Shot BL21 (DE3) E. coli Thermofisher C600003
One Shot TOP10 E. coli Thermofisher C404010

Chemicals, Peptides, and Recombinant Proteins

Trifluoperazine dihydrochloride Sigma-Aldrich T8516
W-7 hydrochloride Sigma-Aldrich 681629
L-741,626 Sigma-Aldrich L135
Terazosin hydrochloride Sigma-Aldrich T4680
H89 Tocris 2910
Gö6983 Tocris 2285/1
1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) Sigma 42773
2-Oleoyl-1-palmitoyl-sn-glycero-3-phospho-rac-(1-glycerol) (POPG) Sigma 76559
Cholesterol Sigma C8667
5(6)-Carboxyfluorescein Sigma 21877
Alexa Fluor 488 maleimide ThermoFisher A10254
NH4Cl (15N, 99%) Cambridge Isotopes NLM-467-5; CAS# 39466-62-1
D-glucose (1-13C, 98-99%) Cambridge Isotopes CLM-1396-5; CAS# 110187-42-3
Glutathione Sepharose 4B GE Healthcare 17-075601
PreScission protease GE Healthcare 27-084301
Phos-Tag acrylamide NARD Institute AAL-107
2,2-dimethyl-2-silapentane-5-sulfonate Cambridge Isotopes DLM-32-10; CAS# 2039-96-5
D2O (D, 99.96%) Cambridge Isotopes DLM-6-1000; CAS# 7789-20-0
Amicon Ultra-15 centrifugal filter unit Millipore-Sigma UFC900308
M9 minimal media salts Millipore-Sigma M9956-500ML
Recombinant human AQP4 (UniProtID P55087) Öberg et al., 2011 N/A
Recombinant human AQP4- Δ256 This paper N/A
Recombinant human AQP4-F258/262/268A This paper N/A
Recombinant human AQP4-S276E This paper N/A
Recombinant GST-recAQP4ct (containing human AQP4 residues 254-323) This paper N/A
Recombinant human calmodulin S17C (UniProtID P0DP23) O’Connell et al., 2010 N/A
Recombinant chicken calmodulin Nakashima et al., 1996 N/A
Bovine heart cAMP-dependent protein kinase (PKAc) Hofmann et al., 1975 N/A
EZ-Link Sulfo-NHS-SS-biotin, cell impermeable biotinylation reagent ThermoFisher 21331
Calcein-AM ThermoFisher C3100MP

Critical Commercial Assays

RNeasy Plus Mini Kit QIAGEN 74134
QIAquick PCR Purification Kit QIAGEN 28104
Pierce BCA Protein Assay Kit ThermoFisher 23225
ELISA-based assay kit for PKA activity Abcam ab139435
ELISA-based assay kit for Akt activity Abcam ab139436

Experimental Models: Cell Lines

Rat primary cortical astrocytes GIBCO N7745100
Human cerebral cortex primary astrocytes Sciencell 1800
HEK293 ATCC CRL-1573

Experimental Models: Organisms/Strains

Rats/Sprague-Dawley Charles River UK CD IGS
Pichia pastoris strain X-33 Thermo Fisher C18000

Oligonucleotides

Primer recAQP4ct: NT forward 5′-GCGCGGATCCCCAGATGT
TGAATTCAAACG
This study N/A
Primer recAQP4ct: NT reverse 5′-CCATCTGGAGAGGTATT
GTCTTCA
This study N/A
Primer recAQP4ct: CT forward 5′-CAATCTGGAGAGGTATT
GTCTTCAGTATAAGCGGCCGCGCGC
This study N/A
Primer recAQP4ct: CT reverse 5′- GCGCGCGGCCGCTTAT
ACTGAAGACAATACCTCTCCAGATTG
This study N/A

Recombinant DNA

pGFP-C-shLenti-AQP4 Origene Cat no. TL709442, Locus ID: 25293
pGFP-C-shLenti-Control Origene Cat no. TR30021
pDEST47-hAQP4-His6 This study N/A
pDEST47-hAQP4-F258A-His6 This study N/A
pDEST47-hAQP4-F262A-His6 This study N/A
pDEST47-hAQP4-F266A-His6 This study N/A
pDEST47-hAQP4-F258/262/266A-His6 This study N/A
pGEX-6P1 GE Healthcare 27-1542-01

Software and Algorithms

NMRPipe NIST IBBR https://www.ibbr.umd.edu/nmrpipe/
NMRViewJ NMRFx http://nmrfx.org/nmrfx/nmrviewj