Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Srsf10 | ncbi | GeneID:14105 | Exons 2–4 |
| Gene (Homo sapiens) | Gmfb | ncbi | GeneID:2764 | Exon 4–5 |
| Gene (Homo sapiens) |
Srsf10 | ncbi | GeneID:10772 | |
| Cell line (Homo sapiens) | HeLa | ATCC | RRID:CVCL_0030 | |
| Cell line (Homo sapiens) | HEK293 | ATCC | RRID:CVCL_0045 | |
| Cell line (Homo sapiens) | HEK293ΔE3 | This paper | CRISPR/Cas9-mediated deletion of Srsf10 exon 3; see Figure 4
and Materials and methods Part |
|
| Biological sample (Mus musculus, NMRI strain) | Cortices | This paper | developmental stages E 12.5 and E 15.5; see Figure 4 and Materials and methods Part | |
| Antibody | anti-FUSIP1 (T-18) (human, monoclonal) | Santa Cruz Biotechnology | RRID:AB_1123037 | 1:1000 |
| Antibody | Anti-GFP (B-2)(monoclonal) | Santa Cruz Biotechnology | RRID:AB_627695 | 1:5000 |
| Antibody | anti-Vinculin (H-300) (rabbit, polyclonal) | Santa Cruz Biotechnology | RRID:AB_2214507 | 1:1000 |
| Antibody | anti-hnRNP L (4D11) (human, monoclonal) | Santa Cruz Biotechnology |
RRID:AB_627736 | 1:10000 |
| Recombinant DNA reagent | Mouse Srsf10 minigene | This paper | See Figure 1 + with Figure 1—figure supplements 1 and 2; and Materials and methods part | |
| Recombinant DNA reagent |
mouse Srsf10-fl-GFP | This paper | See Figure 1 + with Figure 1—figure supplements 1 and 2; and Materials and methods part | |
| Recombinant DNA reagent | mouse Srsf10-2-GFP | This paper | See Figure 1 + with Figure 1—figure supplements 1 and 2; and Materials and methods part | |
| Recombinant DNA reagent | mouse Srsf10-s-GFP | This paper | See Figure 1 + with Figure 1—figure supplements 1 and 2; and Materials and methods part | |
| Recombinant DNA reagent | PX459 vector | Kindly provided by Stefan Mundlos | RRID:Addgene_62988 | For sgRNA cloning and transfection |
| Recombinant DNA reagent | pEGFP-N3 | Clontech | SRSF10 expression construct | |
| Recombinant DNA reagent | pcDNA3.1(+) | Invitrogen | Catalog no: V79020 | Minigene cloning |
| Sequence-based reagent | siRNA against human Srsf10 (siSrsf10) | This paper | GCGUGAAUUUGGUUAUdTdT | Knockdown of endogenous Srsf10 |
| Sequence-based reagent | siRNA against human Rnpc3 (siRnpc3) | This paper | GAAAGAAGGUCGUAUGAAAdTdT | Knockdown of endogenous Rnpc3 |
| Sequence-based reagent | Control siRNA (siCtrl) | This paper | UUUGUAAUCGUCGAUACCCdTdT | |
| Sequence-based reagent | sgRNA: SRSF10_E3_3fw | Benchling Tool | RRID:SCR_013955 | Sequence: caccgctactttactcggtaagcca; CRISPR/Cas9-mediated deletion of Srsf10 exon 3 |
| Sequence-based reagent | sgRNA: SRSF10_E3_3rv | Benchling Tool | RRID:SCR_013955 | Sequence: aaactggcttaccgagtaaagtagc; CRISPR/ Cas9-mediated deletion of Srsf10 exon 3 |
| Sequence-based reagent | sgRNA: SRSF10_E3_5fw | Benchling Tool | RRID:SCR_013955 | Sequence: caccgtgagtttcagaagcatgaat; CRISPR/Cas9-mediated deletion of Srsf10 exon 3 |
| Sequence-based reagent | sgRNA: SRSF10_E3_5rv |
Benchling Tool | RRID:SCR_013955 | sequence: aaacattcatgcttctgaaactcac; CRISPR/Cas9-mediated deletion of Srsf10 exon 3 |
| Commercial assay or kit | PowerUp SYBR Green Mastermix | ThermoFisher Scientific | A25742 | RT-qPCR |
| Chemical compound, drug |
Roti-Fect | Carl Roth | Order no:P001.1 | Plasmid vector transfection |
| Software, algorithm | GraphPad Prism 7.05 | GraphPad | RRID:SCR_002798 | Statistical analysis |
| Software, algorithm | ImageQuant TL | GE Life Sciences | RRID:SCR_014246 | quantification |
| Software, algorithm | Whippet v0.11 | Sterne-Weiler et al., 2018 | RRID:SCR_018349 | Tpm calculation |
| Software, algorithm | Salmon v1.2.0 | Patro et al., 2017 | RRID:SCR_017036 | Tpm calculation |
| Software, algorithm | TxImport v1.14.0 | Soneson et al., 2015 | RRID:SCR_016752 | Import of transcript counts to R for normalization wit DESeq |
| Software, algorithm | DESeq2 v1.26.0 | Love et al., 2014 | RRID:SCR_015687 | Transcript counts normalization |