Skip to main content
. 2020 May 24;42:19. doi: 10.1186/s41021-020-00158-y

Table 2.

Summary of Spi mutations in the brain of X-ray-irradiated WT and scid mice

Types of deletions Position Position Sequence Sequence No. of mutants
in gam in lambda EG10 Change a at junction b,c WT scid WT scid
0 Gy 0 Gy 10 Gy 10 Gy
One base pair deletions
 In run sequences
141–142 GG→G 1
188–190 CCC→CC 1
199–201 AAA→AA 1
227–231 AAAAA→AAAA 5d 1 5d 11d
238–241 CCCC→CCC 2d 1 1 2d
286–289 GGGG→GGG 5d 1 3d 12d
290–291 CC→C 1 1
295–300 AAAAAA→AAAAA 6d 3d 15d 9d
316–318 TTT→TT 1
334–336 TTT→TT 2
377–378 CC→C 1
380–381 TT→T 1
387–388 CC→C 1
390–391 CC→C 1
 Other 1 bp deletion
131 ttAtt→tttt 1
175 cacTac→cacac 1
183 caGct→cact 1
203 gAgg→ggg 1
218 agAcg→agcg 1
236 ccTgc→ccgc 1
268 tcGat→tcat 1
276 tttG→ttt 1
277 ttgCaac→ttgaac 2d
285 Cgggg→gggg 1
294 Caaaaaa→aaaaaa 1
301 aaaaaaT→aaaaaa 1
320 tttgAt→tttgt 1
328 tGtt→ttt 1
332 gAg→gg 1
341 ggAg→ggg 1
392 ccAgg→ccgg 1
>  2 bp deletions
 Deleted sizes (bp)
  2 153 → 156 tgag tcag 1
  2 251 → 254 tgtt aatc 1
  2 349 → 352 atgg gaac 1
  3 355 → 359 gaac tccg 1
  4 182–184 → 187–189 agcaGCccgt 1
  4 222 → 227 cgac aaaa 1
  4 239–240 → 244–245 tgccCacct 1
  4 247–249 → 251–253 caccTgaat 1
  4 295–300 cagcAAtcca 1
  4 304 → 309 tcca ccgt 1
  5 300–301 → 306–307 aaaaTaccc 2
  7 147–149 → 155–157 tcgtCTcaga 1
  7 349–351 → 357–359 atggCAtccg 1
  8 175 → 184 cact ctcg 1
  10 196–198 → 207–209 gaagAGaact 1
  10 323 → 334 atga tttc 1
  10 335 → 346 agtt atgg 1
  10 375–379 → 386–390 tgaaACcacc 1
  12 221–222 → 234–235 acgaCctgc 1
  12 313 → 326 cgtg atgt 1
  13 376–379 → 389–392 gaaaCCAggtt 1
  14 165–167 → 180–182 ctggGcagc 1
  17 154–155 → 172–173 gaggCacta 1
  17 239–240 → 257–258 ctgcCgcta 1
  17 251 → 269 tgtt atca 1
  19 212–215 → 232–235 aactGGCctgc 1
  22 288–289 → 311–312 cgggGtgcg 3
  26 268 → 285 atcg cggg 2d
  28 307 → 336 atta tcag 1
  28 338 → 367 ttca atgg 1
  32 189–190 → 222–223 cgccCatgg 1
  34 346–348 → 381–383 cgcaTGctca 1
  41 380 → 422 ccat aatg 1
  49 206 → 257 (1 bp ins.) aggc C cgct 1
  67 246–247 → 314–315 gcacCgttt 1
  76 189 → 266 cgcc tcga 1
  86 252–253 → 339–340 gtttGgagc 1
  107 91–92 → 199–200 cgatAaaga 1
  124 208 → 333 gcag gttt 1
  127 273–276 → 401–404 tcatTTGattc 1
  151 24,867–24,870 → 25,019–25,022 cgacACGcacg 1
  432 24,828–24,830 → 25,261–25,263 gagtGGgctg 1
  449 24,683–24,684 → 25,133–25,134 cccaCtttc 1
  596 24,446–24,450 → 25,043–25,047 ataTGGCcccg 1
  654 24,719 → 25,374 aagg tcgc 1
  1248 24,524–24,536 → 25,767–25,779 aatgGTTCGCGGCGGCgtg 2
  1436 24,563 → 26,000 caga cagt 1
  1557 24,222 → 25,802 (22 bps ins.) tgtc CATTCAAAACACACCACCAAAG ctcc 1
  1616 23,938–25,555 (2 bps ins.) aaac AG gcct 1
  1856 23,960–23,961 → 25,817–25,818 gaagTtggt 1
  1874 24,161–24,162 → 26,009–26,010 tgttTgctg 1
  2124 23,141 → 25,266 (1 bp ins.) tcgg A gatt 2
  2388 23,000–23,004 → 25,389–25,393 tgctGCGAtag 1
  2388 24,000–24,002 → 28,232–28,234 gggGTgtca 1
  2441 24,034–24,035 → 26,476–26,477 cggtGccag 1
  2842 24,247–24,248 → 27,090–27,091 agcGccga 1
  3628 25,062 → 28,691 aaa ctg 1
  3701 24,560 → 28,262 gatg gcac 1
  3707 21,458–21,459 → 25,166–25,167 attGcgcc 1
  3979 22,200–22,204 → 26,180–26,184 ccagTTTAtttt 2
  4144 22,585–22,586 → 26,730–26,731 cgttCtgcc 1
  4689 23,611–23,612 → 28,301–28,302 agttGcgcg 1
  4698 24,423–24,424 → 29,122–29,123 gaaGtgcc 1
  4841 21,691–21,692 → 26,533–26,534 agacAtcat 1
  5037 21,355 → 26,393 ctct agaa 1
  5251 19,712–19,713 → 24,964–24,965 caccAccat 1
  5422 22,340 → 27,760 (3 bps ins.) cgcc TTT caca 1
  5562 19,997 → 25,560 atag gatt 1
  5727 19,335 → 25,063 tggc tgat 1
  6900 24,036 → 30,937 gtga gatc 1
  7303 23,917 → 31,221 cttc tcgt 1
  9030 21,854–21,857 → 30,885–30,888 gagtACGcttt 1
Insertions
  + 1 227–231 AAAAA→AAAAAA 1
  + 1 227–231 AAAAA→AAAAAA 1
  + 1 295–300 AAAAAA→AAAAAAA 4d
  + 1 356 aaca→aacTa 1
Complex
 N.D. 23,999 → 24,381, 23,997–23,996 → 27,762–27,763 1
 N.D. 21,108–21,109 → 13–14 1
25 8 72 95

a Capital letters are deleted or Inserted bases

b Bold and underlined bases denote homologous sequences of deletion junctions

c Bold and italic bases denote inserted sequences at deletion junctions

d The mutations were independently observed from more than two different mice