Abstract
Premise
Camellia reticulata, which is native to southwestern China, is an economically important plant belonging to the family Theaceae. We developed expressed sequence tag–simple sequence repeat (EST‐SSR) markers for C. reticulata, which can be used to investigate its genetic diversity, population structure, and evolutionary history.
Methods and Results
We detected 4780 SSRs in C. reticulata from Camellia RNA‐Seq data deposited in the National Center for Biotechnology Information's expressed sequence tags database (dbEST). Primer pairs for 70 SSR loci were designed and used for PCR amplification using 90 individuals from four populations of C. reticulata. Of these loci, 50 microsatellite markers were successfully identified, including 11 polymorphic markers. The allele number per locus ranged from two to seven (mean = 4.182), and the levels of observed and expected heterozygosity ranged from 0.044 to 0.567 and from 0.166 to 0.642, respectively. Eleven primer pairs amplified PCR products in three other species of Camellia (C. saluenensis, C. pitardii, and C. yunnanensis).
Conclusions
The set of microsatellite markers developed here can be used to study the genetic variation and population structure of C. reticulata and related species and thereby help to develop conservation strategies for this species.
Keywords: Camellia reticulata, expressed sequence tag–simple sequence repeat (EST‐SSR) marker, polymorphism, Theaceae
Camellia reticulata Lindl. (Theaceae) is an economically important ornamental flowering shrub or small tree that grows in Yunnan Province, southwestern Sichuan Province, and western Guizhou Province of China (Ming et al., 2000). As an ornamental plant, C. reticulata has over 1000 years of history of cultivation, and many outstanding cultivars have been selected or bred from wild C. reticulata for many centuries in China (Xia et al., 1994; Gu, 1997). Camellia reticulata is notable for its large flowers, brilliant colors, numerous cultivars, and long flowering duration (Xia et al., 1994; Ming et al., 2000). Furthermore, it is valued not only as a flowering ornamental but also as a source of oils. Its seeds have a high content of oil that is rich in unsaturated fatty acids, oleic acid, vitamin E, and other physiologically active substances, making it a valuable edible oil source for daily consumption (Liu and Ma, 2010). Camellia reticulata is a perennial, outcrossing, heterogenous polypoid species (2n = 30) (Kondo et al., 1986). Its natural populations across southwestern China have different ploidy levels (i.e., 2n = 2x, 4x, 6x; x = 15), which could have resulted from natural hybridization and polyploidization (Gu, 1997). Fluorescence in situ hybridization and genomic in situ hybridization for C. reticulata indicate that C. japonica L., C. saluenensis Stapf ex Bean, C. pitardii Cohen‐Stuart, and C. yunnanensis (Pit. ex Diels) Cohen‐Stuart might have contributed to the origin and evolution of the C. reticulata polyploid complex (Gu and Xiao, 2003; Liu and Gu, 2011).
In recent years, there has been a decline in the number and size of natural populations of C. reticulata because of overharvesting and habitat destruction. This alarming situation necessitates an in‐depth understanding of the current status of the genetic diversity of the species. Studies have been conducted on the genetic diversity of C. reticulata via inter‐simple sequence repeat markers, chloroplast microsatellites, and amplified fragment length polymorphisms (Wang and Ruan, 2012; Tong et al., 2013; Yao et al., 2016; Xin et al., 2017). Yao et al. (2016) designed 20 expressed sequence tag–simple sequence repeat (EST‐SSR) primer pairs based on the transcriptome of diploid C. reticulata. Of these, 18 were successfully amplified, detecting seven polymorphic loci in 24 C. reticulata individuals. We further tested these 20 markers in four natural populations, showing four loci with polymorphisms. These are not sufficient for inclusive studies on C. reticulata. Therefore, in this study, we aimed to develop new microsatellite markers that will help to investigate the reproductive characteristics of C. reticulata, evaluate its evolutionary potential, and develop effective strategies for the conservation, development, and utilization of wild natural populations. In addition, we tested the cross‐species transferability of these markers in three other species of Camellia: C. saluenensis, C. pitardii, and C. yunnanensis, which are thought to be involved in the polyploidy of C. reticulata.
METHODS AND RESULTS
Fresh healthy leaves collected from 90 individuals of C. reticulata sampled from four wild populations from Yunnan Province, China, were freeze‐dried or silica‐dried. Forty samples from three populations of C. saluenensis, C. pitardii, and C. yunnanensis were also collected to test the cross‐amplification of the markers. Voucher specimens were deposited at the Kunming Institute of Botany, Chinese Academy of Sciences (KUN) (Appendix 1). Genomic DNA was extracted from 20–30 mg of dried leaf tissue using a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987).
We obtained 50,287 EST sequences from the National Center for Biotechnology Information (NCBI) expressed sequence tags database (dbEST) (accessed on June 2019) (Boguski et al., 1993). To obtain a nonredundant EST data set for SSR identification and primer design, vectors were removed from EST sequences using SeqTrim (Falgueras et al., 2010) and poly(A) tails were trimmed using est‐trimmer.pl. Clean EST sequences were then clustered and assembled into contigs and singletons using CAP3 (Huang and Madan, 1999), generating 17,989 unigenes consisting of 5099 contigs and 12,890 singletons. These unique sequences were further used to screen for the presence of microsatellites using the MISA Perl program (Thiel et al., 2003). The criteria for SSRs were set as sequences having at least 10, six, five, five, five, and five repeat units for mono‐, di‐, tri‐, tetra‐, penta‐, and hexanucleotide motifs, respectively. In total, 4780 SSRs were identified, with an average frequency of 1 SSR/1.57 kbp. Primers were designed using Primer Premier 5.0 software (PREMIER Biosoft International, Palo Alto, California, USA) with the following criteria: primer lengths of 16–22 bp, GC content of 40–65%, annealing temperature ranging from 40°C to 60°C, and a predicted PCR product size ranging from 100 to 300 bp.
We randomly selected 70 primer pairs and tested them for PCR amplification in 12 accessions of C. reticulata (three individuals in each population, Appendix 1) in an initial screening test. PCR amplification was performed in an 18‐μL reaction mixture containing 20–30 ng of genomic DNA, 9 μL of 2× Easy Taq PCR Super Mix (TransGen Biotech, Beijing, China), and 1 μL of each primer (10 μM), adding ddH2O to a final volume of 18 μL. Cycling consisted of 30 s of denaturation at 94°C, 30 s at the optimized annealing temperature (Table 1), and a 1‐min extension at 72°C for 32 cycles, followed by a final extension at 72°C for 5 min. The amplified products were separated on 8% polyacrylamide denaturing gels, and the bands were developed with silver staining with a 2‐kbp DNA Ladder Marker (Hangzhou Bioer Technology Co. Ltd., Hangzhou, China) as a reference. The ploidy level of the sampled populations was unknown, but multiple copy bands per locus due to polyploidy were not observed. Of the 70 primer pairs tested, 50 yielded clear and reproducible amplicons in C. reticulata; the others were unstable or gave no product. Eleven loci showed polymorphisms (Table 1), and 39 loci were monomorphic (Appendix 2). These 11 polymorphic primers were used in 90 individuals of C. reticulata (four populations) for the population genetic analyses using the same protocol as the initial test. The polymorphic SSR loci were analyzed with POPGENE 32 software (Yeh et al., 2000) and GenAlEx (Peakall and Smouse, 2006) for the number of alleles per locus, observed heterozygosity, and expected heterozygosity (Table 2). Hardy–Weinberg equilibrium by 1000 randomizations and linkage disequilibrium were estimated using POPGENE 32 software (Yeh et al., 2000).
Table 1.
Characteristics of 11 polymorphic microsatellite loci developed in Camellia reticulata.a
| Locus | Primer sequences (5′–3′) | Repeat motif | Expected allele size (bp) | T a (°C) | Putative function (Organism) | GenBank accession no. |
|---|---|---|---|---|---|---|
| CSSR2 | F: GGAATAGGCTCGGATGGT | (TTG)7 | 186 | 54 | Hypothetical protein TEA_012945 (Camellia sinensis var. sinensis) | FS951581.1 |
| R: CTCTCTGCTTCTTCACAAATC | ||||||
| CSSR5 | F: GCTGTAGGCGAACATGAA | (GGTGCT)6 | 196 | 55 | Glycine‐rich cell wall structural protein 1.8‐like (Camellia sinensis) | FS952802.1 |
| R: CACTTCCACTTCCATATCCA | ||||||
| CSSR11 | F: GCCCTAACTCTTCACTGTA | (AG)18 | 123 | 56 | Growth‐regulating factor 4‐like isoform X2 (Camellia sinensis) | FS950234.1 |
| R: CTATGTCGGCTAGGTTCTT | ||||||
| CSSR17 | F: AGAGGAGAGGAGAGGAGAG | (CCTCCA)7 | 130 | 54 | NONE | GH710908.1 |
| R: TTTGGAGAGCGACATTGC | ||||||
| CSSR18 | F: TCGCTGCTCTCATCTACT | (CTT)9 | 114 | 56 | Hypothetical protein TEA_017838 (Camellia sinensis var. sinensis) | FS945416.1 |
| R: TCTACATGGACATGGACTTAG | ||||||
| CSSR19 | F: GCTCATGCCATGTCATCC | (CT)12 | 167 | 55 | sm‐like protein LSM1B (Camellia sinensis) | GH710926.1 |
| R: TACCCTCATATCAACCTTGTG | ||||||
| CSSR35 | F: ATCGCAGACAACAAGAAGA | (TGA)6 | 105 | 55 | Probable E3 probable E3 ubiquitin‐protein ligase XERICO (Camellia sinensis) | FS947941.1 |
| R: GGAGGAGATCGTGATGAAG | ||||||
| CSSR36 | F: AGGCTTAGGTGTAGATAGGT | (TC)16 | 117 | 54 | Histone H1‐like protein (Camellia sinensis) | JK711494.1 |
| R: ACTCCAACTCTTCCACAAC | ||||||
| CSSR38 | F: GCTATTGACGCTAATGACC | (TGA)6 | 117 | 55 | Protein PAT1 2 like (Actinidia chinensis var. chinensis) | FS949009.1 |
| R: CCAGAAATCATAACGCAACA | ||||||
| CSSR45 | F: GTATGACAGATACCATGAACC | (T)21 | 157 | 55 | Hypothetical protein TEA_005759 (Camellia sinensis var. sinensis) | FF682781.1 |
| R: TGAAACCAAACCCACACT | ||||||
| CSSR48 | F: ATTACCACCACCACTATCAC | (TGG)8 | 143 | 55 | ABA‐inducible protein PHV A1‐like (Camellia sinensis) | GH738605.1 |
| R: CCCAAAGAAAGACCAAAGAC |
T a = annealing temperature.
All values are based on 90 samples representing populations from southwestern China (N = 18–27 for each); see Appendix 1 for locality and voucher information.
Table 2.
Genetic variation in the 11 polymorphic EST‐SSR markers in four Camellia reticulata populations.a
| Locus | TC (n = 18) | XD (n = 26) | SM (n = 19) | CX (n = 27) | Total (n = 90) | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | HWE | A | H o | H e | HWE | A | H o | H e | HWE | A | H o | H e | HWE | A | H o | H e | |
| CSSR2 | 3 | 0.222 | 0.541 | 0.032 | 3 | 0.462 | 0.503 | 0.237 | 2 | 0.000 | 0.102 | 0.000b | 2 | 0.000 | 0.140 | 0.000b | 3 | 0.178 | 0.372 |
| CSSR5 | 2 | 0.167 | 0.322 | 0.029 | 3 | 0.462 | 0.585 | 0.000b | 3 | 0.053 | 0.363 | 0.000b | 3 | 0.296 | 0.319 | 0.008 | 3 | 0.267 | 0.428 |
| CSSR11 | 4 | 0.222 | 0.630 | 0.000b | 4 | 0.115 | 0.664 | 0.000b | 5 | 0.000 | 0.677 | 0.000b | 4 | 0.037 | 0.505 | 0.000b | 5 | 0.089 | 0.636 |
| CSSR17 | 4 | 0.722 | 0.589 | 0.618 | 5 | 0.846 | 0.686 | 0.000b | 3 | 0.053 | 0.317 | 0.000b | 4 | 0.111 | 0.357 | 0.000b | 7 | 0.433 | 0.518 |
| CSSR18 | 3 | 0.722 | 0.643 | 0.026 | 5 | 0.846 | 0.787 | 0.000b | 4 | 0.421 | 0.563 | 0.000b | 3 | 0.296 | 0.377 | 0.144 | 6 | 0.567 | 0.642 |
| CSSR19 | 2 | 0.000 | 0.508 | 0.000b | 2 | 0.462 | 0.498 | 0.705 | 2 | 0.000 | 0.102 | 0.000b | 2 | 0.148 | 0.201 | 0.136 | 2 | 0.178 | 0.422 |
| CSSR35 | 2 | 0.056 | 0.056 | 1.000 | 3 | 0.039 | 0.112 | 0.000b | 2 | 0.000 | 0.102 | 0.000b | 3 | 0.148 | 0.322 | 0.000b | 3 | 0.067 | 0.166 |
| CSSR36 | 3 | 0.111 | 0.641 | 0.000b | 4 | 0.039 | 0.612 | 0.000b | 3 | 0.000 | 0.199 | 0.000b | 3 | 0.037 | 0.238 | 0.000b | 4 | 0.044 | 0.471 |
| CSSR38 | 3 | 0.222 | 0.298 | 0.000b | 4 | 0.192 | 0.250 | 0.000b | 2 | 0.000 | 0.398 | 0.000b | 5 | 0.111 | 0.357 | 0.000b | 5 | 0.133 | 0.330 |
| CSSR45 | 3 | 0.778 | 0.560 | 0.267 | 4 | 0.769 | 0.719 | 0.012 | 4 | 0.158 | 0.289 | 0.000b | 3 | 0.444 | 0.444 | 0.000b | 5 | 0.544 | 0.580 |
| CSSR48 | 3 | 0.722 | 0.532 | 0.220 | 2 | 0.000 | 0.462 | 0.000b | 2 | 0.000 | 0.102 | 0.000b | 2 | 0.074 | 0.352 | 0.000b | 3 | 0.167 | 0.465 |
| Mean | 2.909 | 0.359 | 0.484 | 3.546 | 0.385 | 0.534 | 2.909 | 0.062 | 0.292 | 3.091 | 0.155 | 0.328 | 4.182 | 0.242 | 0.457 | ||||
A = number of alleles sampled; H e = expected heterozygosity; H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; n = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
Chi‐square test for Hardy–Weinberg equilibrium. Locus showed significant deviations from Hardy–Weinberg equilibrium (P < 0.001).
Among the 11 polymorphic loci, the number of alleles per locus ranged from two to seven with a mean of 4.182. The levels of observed and expected heterozygosity were 0.044–0.567 and 0.166–0.642, with averages of 0.242 and 0.457, respectively (Table 2). Four SSR markers were able to detect levels of expected heterozygosity above 0.5, indicating a high level of polymorphism in C. reticulata. All 11 polymorphic loci showed deviation from Hardy–Weinberg equilibrium within two or more populations (Table 2) as a result of heterozygosity deficits. This was most likely the result of the reproduction mode, habitat fragmentation, and inbreeding. We found no consistent deviation from linkage disequilibrium for any loci within the populations (P < 0.001). Cross‐species amplification of the 11 polymorphic loci was tested on C. saluenensis, C. pitardii, and C. yunnanensis. All 11 EST‐SSR markers were amplified successfully, using the same PCR protocol for C. reticulata, and were shown to be polymorphic (Table 3).
Table 3.
Cross‐amplification and genetic diversity statistics of EST‐SSR markers developed for Camellia reticulata in three related species.a
| Locus | Camellia saluenensis | Camellia pitardii | Camellia yunnanensis | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| JCPT (n = 13) | JCPL (n = 15) | JCYN (n = 12) | ||||||||||
| A | A e | H o | H e | A | A e | H o | H e | A | A e | H o | H e | |
| CSSR2 | 3 | 1.476 | 0.154 | 0.335 | 2 | 1.385 | 0.067 | 0.287 | 2 | 1.180 | 0.000 | 0.159 |
| CSSR5 | 2 | 1.257 | 0.077 | 0.212 | 2 | 1.220 | 0.067 | 0.186 | 1 | 1.000 | 0.000 | 0.000 |
| CSSR11 | 3 | 1.660 | 0.154 | 0.394 | 3 | 1.312 | 0.067 | 0.246 | 3 | 1.405 | 0.083 | 0.301 |
| CSSR17 | 3 | 1.733 | 0.077 | 0.440 | 3 | 1.495 | 0.133 | 0.343 | 2 | 1.280 | 0.083 | 0.228 |
| CSSR18 | 2 | 1.451 | 0.077 | 0.323 | 2 | 1.220 | 0.067 | 0.186 | 2 | 1.280 | 0.083 | 0.228 |
| CSSR19 | 2 | 1.451 | 0.077 | 0.323 | 2 | 1.220 | 0.067 | 0.186 | 1 | 1.000 | 0.000 | 0.000 |
| CSSR35 | 3 | 1.751 | 0.154 | 0.446 | 3 | 1.402 | 0.133 | 0.297 | 3 | 1.412 | 0.000 | 0.304 |
| CSSR36 | 3 | 1.808 | 0.231 | 0.465 | 3 | 1.495 | 0.067 | 0.343 | 3 | 1.412 | 0.000 | 0.304 |
| CSSR38 | 2 | 1.257 | 0.077 | 0.212 | 2 | 1.220 | 0.067 | 0.186 | 2 | 1.180 | 0.000 | 0.159 |
| CSSR45 | 3 | 1.660 | 0.000 | 0.394 | 3 | 1.226 | 0.067 | 0.191 | 2 | 1.180 | 0.000 | 0.159 |
| CSSR48 | 2 | 1.257 | 0.077 | 0.212 | 2 | 1.142 | 0.000 | 0.129 | 1 | 1.000 | 0.000 | 0.000 |
| Mean | 2.546 | 1.514 | 0.105 | 0.342 | 2.455 | 1.303 | 0.073 | 0.235 | 2.000 | 1.212 | 0.023 | 0.168 |
A = number of alleles sampled; A e = effective number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
CONCLUSIONS
The EST‐SSR polymorphic markers developed in this study will add to the existing resources of molecular markers and are expected to be useful for studies on population structure and genetic diversity in C. reticulata. The microsatellite loci described here were successfully cross‐amplified in C. saluenensis, C. pitardii, and C. yunnanensis, suggesting that these markers may also be applicable to the study of genetic diversity in other Camellia species.
ACKNOWLEDGMENTS
This work was supported by the Surface Project of the Natural Science Foundation of Yunnan Province (2016FB031) (to Y.T.), the Key Project of the Natural Science Foundation of Yunnan Province (2015FA030), and the Yunnan Innovation Team Project (to L.Z.G.).
APPENDIX 1.
Locality and voucher information for Camellia species used in this study.a
| Species | Population code | Voucher no. | Location | Geographic coordinates | Elevation (m) | N |
|---|---|---|---|---|---|---|
| C. reticulata Lindl. | TC | CR‐TY‐021 | Mazhan, Tengchong, Yunnan, China | 25°12′03.65″N, 98°28′34.46″E | 1980 | 18 |
| C. reticulata | XD | CR‐TY‐013 | Niujie, Xundian, Yunnan, China | 25°52′57.8″N, 102°59′14.4″E | 2398 | 26 |
| C. reticulata | SM | CR‐TY‐004 | Baiyi, Songming, Yunnan, China | 25°19′21.03″N, 102°53′28.21″E | 2121 | 19 |
| C. reticulata | CX | CR‐TY‐018 | Zixi Mountain, Chuxiong, Yunnan, China | 24°59′54.33″N, 101°25′10.77″E | 2318 | 27 |
| C. saluenensis Stapf ex Bean | JCPT | CS‐TY‐01 | Fuyuan, Songming, Yunnan, China | 25°15′53″N, 102°55′18″E | 2147 | 13 |
| C. pitardii Cohen‐Stuart | JCPL | CP‐TY‐01 | Junzi Mountain, Shizong, Yunnan, China | 24°37′13.58″N, 104°9′28.4″E | 2031 | 15 |
| C. yunnanensis (Pit. ex Diels) Cohen‐Stuart | JCYN | CY‐TY‐01 | Machang, Heqing, Yunnan, China | 26°28′26.68″N, 100°3′13.53″E | 3113 | 12 |
N = number of individuals sampled.
All voucher specimens are deposited in the Herbarium of the Kunming Institute of Botany (KUN), Kunming, Yunnan Province, China.
APPENDIX 2.
Characteristics of 39 monomorphic microsatellite loci developed in Camellia reticulata.
| Locus | Primer sequences (5′–3′) | Repeat motif | Expected allele size (bp) | GenBank accession no. |
|---|---|---|---|---|
| CSSR1 | F: CAAAGCCAAATGGAATTGTC | (A)30 | 179 | FS943489.1 |
| R: GCCAGTGAATTGTAATACGA | ||||
| CSSR3 | F: TTCCTCCATTTGCGTGAAA | (AG)13 | 194 | FS951626.1 |
| R: ACCGTCTAGCCTCCAATC | ||||
| CSSR4 | F: TCGTCAATTCCTTCTTGTTG | (CTT)9 | 128 | FS951901.1 |
| R: TTGGTTACAGATGGAGATGG | ||||
| CSSR6 | F: TGTTCTCAATCCACTCTTCA | (TCA)9 | 140 | FS953739.1 |
| R: GCGACAATAATAGGCTCTTG | ||||
| CSSR7 | F: AAGATGAAAGTGTGGATTCC | (TG)25 | 148 | GH159087.1 |
| R: GTAACAACCATCACCAACAT | ||||
| CSSR8 | F: GCAGTAGTTGTTGAAGTTGAG | (A)31 | 180 | GW863559.1 |
| R: CCAGTGAATTGTAATACGACTC | ||||
| CSSR9 | F: TTGTATGTTCCAAGGCATTG | (A)30 | 201 | GW863563.1 |
| R: GACTCACTATAGGGCGAATT | ||||
| CSSR10 | F: TGCTGTCAACTACCCTTC | (AG)20 | 104 | GW342632.1 |
| R: GGTGCTTGAGTCTGTGAT | ||||
| CSSR12 | F: ACCTTGGCTTTGCTCTCT | (AAG)13 | 135 | GO255031.1 |
| R: TTGACGCCGAAGACTCTC | ||||
| CSSR13 | F: TGCTTGCTATCATACAGTTC | (A)30 | 192 | GW315083.1 |
| R: GCCAGTGAATTGTAATACGA | ||||
| CSSR14 | F: GGATGTGTGTTTAGGACCAT | (A)30 | 196 | GW863601.1 |
| R: ACGGCCAGTGAATTGTAAT | ||||
| CSSR15 | F: TCTAATGCCAAGCCTCAAC | (A)30 | 179 | GH734011.1 |
| R: GACTCACTATAGGGCGAATT | ||||
| CSSR16 | F: TCACTAGACCATGTGCTTA | (A)30 | 187 | GH734178.1 |
| R: GTGAATTGTAATACGACTCC | ||||
| CSSR20 | F: GCAGCTCTCTACTTGTCAT | (A)31 | 206 | GH709471.1 |
| R: GCCAGTGAATTGTAATACGA | ||||
| CSSR21 | F: GTTGCTAAATCTGTTGCTAC | (A)30 | 177 | GH709922.1 |
| R: GCCAGTGAATTGTAAATACGA | ||||
| CSSR22 | F: GAACAATGATGACATCTCCA | (CTCCAG)5 | 107 | GH709760.1 |
| R: ATAAGGGAGGAGTGATTTGG | ||||
| CSSR23 | F: TTGGACACCTTGAATGACT | (A)28 | 114 | GH612882.1 |
| R: TAGTGATTAGCGTGGTCG | ||||
| CSSR24 | F: TGTATGATAGCAAGCTGAAG | (A)28 | 110 | GH613058.1 |
| R: TAGTGATTAGCGTGGTCG | ||||
| CSSR25 | F: GCAGCGAGAACTTTGATG | (A)30 | 210 | GE650217.1 |
| R: GCCAGTGAATTGTAATACGA | ||||
| CSSR26 | F: TCAGACTGTACTTAGTGGTT | (A)30 | 126 | GH623471.1 |
| R: TAGTGATTAGCGTGGTCG | ||||
| CSSR27 | F: CAGTGGATGATTGGTAATTTGG | (A)31 | 176 | GW696815.1 |
| R: AGTGGTATCAGGGCAGAG | ||||
| CSSR28 | F: CACATCTCTCCTGTTGCTA | (A)47 | 148 | FS944961.1 |
| R: CTTCTTGCTTGTCTTTCTTC | ||||
| CSSR29 | F: GCTGTCTGCTTTGTACGA | (GA)11 | 163 | FE861335.1 |
| R: TCTCTTCTCTTCCTCCTCTC | ||||
| CSSR30 | F: AGAAAGAAGCTGCAAGGG | (TTCT)5 | 128 | FE861638.1 |
| R: CGTAGATGAGGCTGGAAG | ||||
| CSSR31 | F: ACGCTGAAGTCCAAATCC | (GCC)6 | 145 | CV699742.1 |
| R: AGTGGTCTCCTGTGCTAC | ||||
| CSSR32 | F: ACACTCACTCAATCACTGTT | (A)29 | 207 | GH733834.1 |
| R: TGTAATACGACTCACCATAGG | ||||
| CSSR33 | F: GCAAATGTTGGGCTTGTT | (A)29 | 172 | FS959890.1 |
| R: GCCAGTGAATTGTAATACGA | ||||
| CSSR34 | F: CATCGCATCGTCGTCATC | (TC)15 | 128 | FS947495.1 |
| R: GATCCGACACTTGAACTTGA | ||||
| CSSR37 | F: ACCCAAAGCAAAGCCAAT | (AG)13 | 103 | FS948821.1 |
| R: AACTAGCTGAAGATAGAGGAG | ||||
| CSSR39 | F: TTCATCACAGACACCATCA | (TTTC)8 | 100 | FS949741.1 |
| R: TCACCAATCACAAATCACAG | ||||
| CSSR40 | F: GGCTATGTACTTGATGTTCTTC | (A)23 | 197 | FS954738.1 |
| R: CCAGTGAATTGTAATACGACTC | ||||
| CSSR41 | F: CCTCCTCTATCTTCGATCAATA | (GA)10 | 110 | FS949096.1 |
| R: CGTTAAAGCCATTTCTCTCT | ||||
| CSSR42 | F: GTAACGATTGAATCTGGCAT | (A)20 | 186 | GH623925.1 |
| R: TCACTATAGGGCGAATTGG | ||||
| CSSR43 | F: CGCTATTTATCCTTGCTGTT | (A)23 | 133 | GH623383.1 |
| R: GTGGTATCAACGCAGAGTA | ||||
| CSSR44 | F: CCACCATCACATCCTTACA | (CAC)5 | 157 | FS949501.1 |
| R: GTGGAGGAGGAGATGAGTA | ||||
| CSSR46 | F: GCCGTGAAGATAATGTTGG | (A)64 | 149 | GH623235.1 |
| R: TAGTGATTAGCGTGGTCG | ||||
| CSSR47 | F: CTAGTGATTAGCGTGGTC | (T)31(T)34 | 148 | GH623319.1 |
| R: GTTGTGATTACGATCTCTGA | ||||
| CSSR49 | F: TAACCCTATGTAGACCTCAGT | (A)31 | 215 | GW863554.1 |
| R: CCAGTGAATTGTAATACGACTC | ||||
| CSSR50 | F: TCCATAAAGGAACCTCTAGC | (CT)13 | 164 | JK511141.1 |
| R: TCCAAACATACTCCCAAACT |
Tong, Y. , and Gao L.‐Z.. 2020. Development and characterization of EST‐SSR markers for Camellia reticulata . Applications in Plant Sciences 8(5): e11348.
Contributor Information
Yan Tong, Email: tongyan@mail.kib.ac.cn.
Li‐Zhi Gao, Email: lgaogenomics@163.com.
DATA AVAILABILITY
Expressed sequence tag sequences for the newly developed primers have been deposited to the National Center for Biotechnology Information (NCBI)'s GenBank database; accession numbers are listed in Table 1 and Appendix 2.
LITERATURE CITED
- Boguski, M. S. , Lowe T. M., and Tolstoshev C. M.. 1993. dbEST—database for “expressed sequence tags”. Nature Genetics 4(4): 332–333. [DOI] [PubMed] [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Falgueras, J. , Lara A. J., Fernández‐Pozo N., Cantón F. R., Pérez‐Trabado G., and Claros M. G.. 2010. SeqTrim: A high‐throughput pipeline for pre‐processing any type of sequence read. BMC Bioinformatics 11: 38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu, Z. J. 1997. The discovery of tetraploid Camellia reticulata and its implication in studies on the origin of this species. Acta Phytotaxonomica Sinica 35: 107–116. [Google Scholar]
- Gu, Z. J. , and Xiao H.. 2003. Physical mapping of the 18S‐26S rDNA by fluorescent in situ hybridization (FISH) in Camellia reticulata polyploid complex (Theaceae). Plant Science 164: 279–285. [Google Scholar]
- Huang, X. , and Madan A.. 1999. CAP3: A DNA sequence assembly program. Genome Research 9(9): 868–877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kondo, K. , Gu Z. J., Na H. Y., and Xia L.. 1986. A cytological study of Camellia reticulata and its closely related species in Yunnan, China. Kromosomo II 43–44: 1405–1419. [Google Scholar]
- Liu, L. Q. , and Gu Z. J.. 2011. Genomic in situ hybridization identififies genome donors of Camellia reticulata (Theaceae). Plant Science 180: 554–559. [DOI] [PubMed] [Google Scholar]
- Liu, X. K. , and Ma Y. H.. 2010. Comparison of fatty acid between Camellia reticulata f. simpex seed and Camellia oleifera seed in Yunnan. Journal of Kunming University 32: 56–58. [Google Scholar]
- Ming, T. L. , Gu Z. J., Zhang W. J., and Xie L. S.. 2000. Monograph of the genus Camellia. Yunnan Science and Technology Press, Kunming, Yunnan, China. [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thiel, T. , Michalek V., and Graner A.. 2003. Exploiting EST databases for the development and characterization of gene‐derived SSR‐markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
- Tong, Y. , Wu C. Y., and Gao L. Z.. 2013. Characterization of chloroplast microsatellite loci from whole chloroplast genome of Camellia taliensis and their utilization for evaluating genetic diversity of Camellia reticulata (Theaceae). Biochemical Systematics and Ecology 50: 207–211. [Google Scholar]
- Wang, B. Y. , and Ruan Z. Y.. 2012. Genetic diversity and differentiation in Camellia reticulata (Theaceae) polyploid complex revealed by ISSR and ploidy. Genetics and Molecular Research 11(1): 503–511. [DOI] [PubMed] [Google Scholar]
- Xia, L. F. , Gu Z. J., Wang Z. L., Xiao T. J., Wang L., and Kondo K.. 1994. Dawn on the origin of Camellia reticulata: The new discovery of its wild diploid in Jinshajiang Valley. Acta Botanica Yunnannica 16(3): 255–262. [Google Scholar]
- Xin, T. , Huang W. J., Riek J. D., Zhang S., Ahmed S., Johan V. H., and Long C. L.. 2017. Genetic diversity, population structure, and traditional culture of Camellia reticulata . Ecology and Evolution 7: 8915–8926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yao, Q. Y. , Huang H., Tong Y., Xia E. H., and Gao L. Z.. 2016. Transcriptome analysis identifies candidate genes related to triacylglycerol and pigment biosynthesis and photoperiodic flowering in the ornamental and oil‐producing plant, Camellia reticulata (Theaceae). Frontiers in Plant Science 7: 10.3389/fpls.2016.00163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yeh, F. C. , Yang R., Boyle T. J., Ye Z., and Xiyan J. M.. 2000. POPGENE 32, Microsoft Windows–based freeware for population genetics analysis, Version 1.32. Molecular Biology and Biotechnology Center, University of Alberta, Edmonton, Canada. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Expressed sequence tag sequences for the newly developed primers have been deposited to the National Center for Biotechnology Information (NCBI)'s GenBank database; accession numbers are listed in Table 1 and Appendix 2.