Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Danio rerio) | tdgf1 (oep) | ZFIN | RRID:ZFIN_ZDB-GENE-990415-198 | |
| Gene (Danio rerio) | ndr2 (cyc) | ZFIN | RRID:ZFIN_ZDB-GENE-990415-181 | |
| Strain, strain background (Danio rerio) | AB* | ZIRC | RRID:ZFIN_ZDB-GENO-960809-7 | |
| Genetic reagent (Danio rerio) | oeptz257 | Hammerschmidt et al., 1996 | RRID:ZFIN_ZDB-GENO-130130-2 | Point mutation |
| Recombinant DNA reagent | pJZoepFlag1-2 in pcDNA3 (plasmid) |
Zhang et al., 1998 | Template for in vitro transcription | |
| Recombinant DNA reagent |
ndr2 in PCS2+ (plasmid) |
Sampath et al., 1998 | Template for in vitro transcription | |
| Recombinant DNA reagent |
membrane Cherry in PCS2+ (plasmid) |
Gift from Dr Fang Lin | Template for in vitro transcription | |
| Recombinant DNA reagent |
membrane eGFP in PCS2+ (plasmid) |
Wallingford and Harland, 2002 | Template for in vitro transcription | |
| Recombinant DNA reagent | H2B-RFP in PCS2 (plasmid) | Gift from Dr John Wallingford | Template forin vitro transcription | |
| Recombinant DNA reagent |
Drosophila Prickle-GFP (plasmid) |
Jenny et al., 2003 | Template for in vitro transcription | |
| Antibody | Anti-phospho Smad2/3 | Cell Signaling Technology #8828 | RRID:AB_2631089 | IF (1:1000) |
| Antibody | Invitrogen AlexaFluor 488 goat anti-rabbit IgG |
Thermo Fisher #A-11008 |
RRID:AB_143165 | IF (1:1000) |
| Antibody | Roche Anti-digoxigenin-AP Fab fragments | Millipore Sigma #11093274910 |
RRID:AB_2734716 | 1:5000 |
| Commercial assay or kit | Roche Digoxigenin RNA labelling mix | Millipore Sigma #11277073910 |
||
| Other | Roche BM Purple AP staining solution | Millipore Sigma #11442074001 |
||
| Sequenced-based reagent | MO4-vangl2
Morpholino antisense oligonucleotide |
GeneTools (Williams et al., 2012) |
AGTTCCACCTTACTCCTGAGAGAAT | |
| Commercial assay or kit | Invitrogen mMessage mMachine SP6 kit | Thermo Fisher # AM1340 |
||
| Commercial assay or kit | RNeasy Mini kit | Qiagen #74104 |
||
| Chemical compound, drug | Ambion Trizol reagent |
Thermo Fisher #15596018 |
||
| Chemical compound, drug | SB-505124 | Millipore Sigma # S4696 |
50 mM | |
| Peptide, recombinant protein | Roche Pronase | Millipore Sigma #10165921001 |
||
| Other | New-born calf serum | Invitrogen #26010–066 |
||
| Software, algorithm | Imaris | Oxford Instruments | RRID:SCR_007370 | Live cell tracking |
| Software, algorithm | ImageJ/FIJI | ImageJ/FIJI | RRID:SCR_002285 | Image analysis |
| Software, algorithm | Prism 8 | Graphpad | RRID:SCR_002798 | Statistics and graphs |