REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal human MUC5B	Santa Cruz	RRID: AB_2282256
Mouse monoclonal human MUC5AC	Invitrogen	RRID: AB_10978001
Rabbit polyclonal SARS coronavirus nucleocapsid	Invitrogen	RRID: AB_1087200
Mouse monoclonal anti-acetylated tubulin	Sigma-Aldrich	RRID: AB_609894
Rabbit polyclonal prosurfactant protein C	Sigma-Aldrich	RRID: AB_91588
Goat polyclonal AGER	R&D Systems	RRID: AB_354628
Rat monoclonal anti-tubulin	Millipore	RRID: AB_2210391
Goat polyclonal anti-GFP	AbCam	RRID: AB_305643
Rabbit polyclonal anti-GFP	AbCam	RRID: AB_305564
Alexa Fluor phalloidin 647	Invitrogen	RRID: AB_2620155
Alexa Fluor phalloidin 555	Invitrogen	Cat#A34055
Hoechst 33342	Invitrogen	Cat#H3570
Goat anti-CCSP	Sigma-Aldrich	Cat#ABS1673
Alexa Fluor 488-AffiniPure Donkey Anti-Goat IgG (H+L) (min X Ck,GP,Sy Hms,Hrs,Hu,Ms,Rb,Rat Sr Prot) antibody	Jackson ImmunoResearch	RRID: AB_2336933
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555	Invitrogen	RRID: AB_162543
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594	Invitrogen	RRID: AB_2535795
Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Invitrogen	RRID: AB_162542
Alexa Fluor 488-AffiniPure Donkey Anti-Rabbit IgG (H+L) antibody	Jackson ImmunoResearch	RRID: AB_2313584
Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555	Invitrogen	RRID: AB_2536180
Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Thermo Fisher Scientific	RRID: AB_2535864
S230	UNC protein core facility	N/A
S230.15	UNC protein core facility	N/A
S227.14	UNC protein core facility	N/A
S227.9	UNC protein core facility	N/A
MERS-27	UNC protein core facility	N/A
m336	UNC protein core facility	N/A
EDE1-C10	UNC protein core facility	N/A
anti-SARS-CoV N protein	Invitrogen	Cat#PA1-41098
Bacterial and Virus Strains
SARS-CoV-2 WA1 isolate	Natalie J. Thornburg, CDC	GenBank: MT020880
icSARS-CoV-2-WT	This paper	GenBank: MT461669
icSARS-CoV-2-GFP	This paper	GenBank: MT461670
icSARS-CoV-2-nLuc-GFP	This paper	GenBank: MT461671
Biological Samples
Human nasal, tonsil, and lung samples from CF and non-CF subjects	Marsico Lung Institute, UNC	See Table S1 for a list of donors
Human nasal and lung samples from healthy volunteers	NHLBI	See Table S1 for a list of donors
Human lung histology sections from COVID-19 subjects	University of New Mexico, New York Presbyterian Hospital	See STAR Methods
SARS patient serum samples (Toronto)	University Health Network, MaRS Center, Canada	IRB#:UHN REB 03-0250
COVID-19 serum samples	UNC Hospital	IRB#:20-1141
Mouse serum anti SARS-CoV-2 spike	This paper	N/A
Mouse serum anti SARS-CoV-2 nucleocapsid	This paper	N/A
Chemicals, Peptides, and Recombinant Proteins
Recombinant human IL1β protein	R&D Systems	Cat#201-LB-005
Recombinant human IL13 protein	R&D Systems	Cat#213-ILB-005
Recombinant human IFNβ protein	R&D Systems	Cat#8499-IF-010
Hydrocortisone	Sigma	Cat#H0888
EGF	Invitrogen	Cat#PHG0313
Insulin	Sigma	Cat#I5500
Amphotericin B	Fisher Scientific	Cat#BP264550
Gentamincin	GIBCO	Cat#15710-064
Cholera toxin	Sigma	Cat#C8052
Y-27632	Enzo life Science	Cat#ALX-270-333-M025
TRIzol Reagent	ThermoFisher	Cat#15596026
Critical Commercial Assays
Direct-zol RNA Miniprep	ZYMO Research	Cat#R2051
iScript™ Reverse Transcription Supermix for RT-qPCR	BIO-RAD	Cat#1708840
SsoAdvanced Universal Probes Supermix	BIO-RAD	Cat#1725280
RNAScope Multiplex Fluorescent Reagent Kit v2	ACD	Cat#323100
RNAScope 2.5 HD Duplex Reagent Kit	ACD	Cat#322430
RNAScope 2.5 HD Reagent Kit-RED	ACD	Cat#322350
RNAScope probe FOXJ1 (channel 2)	ACD	Cat#476351-C2
RNAScope probe MUC5B (channel 2)	ACD	Cat#449888-C2
RNAScope probe ACE2 (channel 1)	ACD	Cat#848151
RNAScope probe ACE2 (channel 2)	ACD	Cat#848151-C2
RNAScope probe TMPRSS2 (channel 1)	ACD	Cat#470341
RNAScope probe SARS-CoV-2, S gene encoding the spike protein (channel 1)	ACD	Cat#848561
RNAScope probe SARS-CoV-2, Antisense strand of the S gene (channel 1)	ACD	Cat#845701
RNAScope probe SFTPC (channel 2)	ACD	Cat#452561-C2
RNAScope probe HOPX (channel 1)	ACD	Cat#423001
Vector® TrueVIEW® Autofluorescence Quenching Kit	Vector Laboratories	Cat#SP-8400
Taqman probe TBP	Fisher Scientific	Cat#Hs99999910_m1
Taqman probe GAPDH	Fisher Scientific	Cat#Hs02758991_g1
Taqman probe ACE2	Fisher Scientific	Cat#Hs01085333_m1
Taqman probe TMPRSS2	Fisher Scientific	Cat#Hs01122322_m1
Nano-Glo Luciferase Assay	Promega	Cat#N1130
QIAprep Spin Mini-prep Kit	QIAGEN	Cat#27106
ExpiFectamine 293 transfection kit	Thermo	Cat#A14526
NorthernMax-Gly Kit	Invitrogen	Cat#AM1946
QIAquick Gel Extraction kit	QIAGEN	Cat#28706
mMESSAGE mMACHINE T7 transcription kit	ThermoFisher	Cat#AM1344
Chemiluminescent Nucleic Acid Detection Module	ThermoFisher	Cat#89880
Oligotex mRNA Mini Kit	QIAGEN	Cat#70022
Deposited Data
icSARS-CoV-2 WT genomic sequence	GenBank	MT461669
icSARS-CoV-2-GFP genomic sequence	GenBank	MT461670
icSARS-CoV-2-nLuc-GFP genomic sequence	GenBank	MT461671
Experimental Models: Cell Lines
Simian kidney Vero	ATCC	Cat#CCL81
Simian kidney Vero E6	ATCC	Cat#CRL1586
LLC-MK	ATCC	Cat#CCL-7
UNCNN2TS	Marsico Lung Institute, UNC	N/A
Primary nasal cells	Marsico Lung Institute, UNC	N/A
Human bronchial epithelium	Marsico Lung Institute, UNC	N/A
Human alveolar type II pneumocytes	Marsico Lung Institute, UNC	N/A
Human primary lung microvascular endothelial cells	Marsico Lung Institute, UNC	N/A
Human primary lung fibroblasts	Marsico Lung Institute, UNC	N/A
Experimental Models: Organisms/Strains
Mouse: BALB/c	Jackson Labs	Cat#000651
Oligonucleotides
Leader forward primer: 5′- GTTTATACCTTCCCAGGT AACAAACC −3′	This paper	N/A
M gene reverse primer: 5′- AAGAAGCAATGAAGTA GCTGAGCC −3′	This paper	N/A
N gene primer: 5′-GTAGAAATACCATCTTGGACT GAGATC −3′	This paper	N/A
RT-PCR primer: 5′-GCTTCTGGTAATCTATTACTAG ATAAACG-3′	This paper	N/A
RT-PCR primer: 5′- AAGACATCAGCATACTCCTG ATTAGG −3′	This paper	N/A
biotin-labeled oligomer: 5′- BiodT/GGCTCTGTTGGGA ATGTTTTGTATGCG/BiodT-3′	This paper	N/A
Recombinant DNA
7 plasmids of icSARS-CoV-2 WT	This paper	N/A
1 plasmid encoding icSARS-CoV-2-nLuc-GFP reporter	This paper	N/A
1 plasmid encoding icSARS-CoV-2-GFP reporter	This paper	N/A
Software and Algorithms
QuantStudio 6 Flex System	ThermoFisher Scientific	Cat#4485697
QuantStudio Software v1.3	ThermoFisher Scientific	https://thermofisher.com
GraphPad Prism 8	GraphPad	https://graphpad.com
Olyvia V3.1.1	Olympus	https://olympus-lifescience.com
Adobe Photoshop	Adobe	http://www.adobe.com/nl/products/photoshop.html
R version 3.5.1	R Foundation	https://www.r-project.org/
Other
T4 DNA Ligase	NEB	Cat#M0202S
BsmBI	NEB	Cat#R0580
SacI	NEB	Cat#R0156S
PrimeSTAR GXL HiFi DNA polymerase	TaKaRa	Cat#RF220Q