REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
ACE2 (immunostaining)	Abcam	Cat#ab108209; RRID: AB_10862654
SARS-CoV Spike	Sinobiological	Cat#40150-T52
β-IV-tubulin	Abcam	Cat#ab179504
CC10	Millipore	Cat#07-623; RRID: AB_310759
Podoplanin	Sinobiological	Cat#50256-R066
SPC	Abcam	Cat#ab211326
CD68	Abcam	Cat#ab125212
Cleaved Caspase-3	CST	Cat#9661; RRID: AB_2341188
Neutrophil Marker	Santa Cruz Biotechnology	Cat#sc-71674; RRID: AB_2167794
GAPDH	Abcam	Cat#ab9485; RRID: AB_307275
horseradish peroxidase (HRP)-conjugated anti-mouse IgG	Abcam	Cat#ab6728; RRID: AB_955440
horseradish peroxidase (HRP)-conjugated anti-rabbit IgG	Abcam	Cat#ab205718; RRID: AB_2819160
ACE2 (Western Blotting)	Huabio	Cat#ET1611-58; RRID: AB_11158910
Virus Strains
SARS-CoV-2 BetaCoV/Wuhan/AMMS01/2020	This paper	N/A
Chemicals, Peptides, and Recombinant Proteins
DMEM	GIBCO	Cat#11995-065
Fetal Bovine Serum	PAN Biotech	Cat#P30-3306
Penecillin Streptomycin	GIBCO	Cat#15140-122
HEPES	GIBCO	Cat#15630-080
RNAlater	Invitrogen	Cat#AM7020
retrieval/elution buffer	Abcracker	Cat#ABCFR5L
Streptavidin-peroxidase conjugate	Zhongshan Biotechnology	Cat#SP-9000
low-melting point agarose	Promega	Cat#V2111
Pierce ECL Western Blotting Substrate	Thermo	Cat#32106
pelltobarbitalum natricum	Sigma	Cat#P3761
NcoI	Thermo	Cat#FD0595
StuI	Thermo	Cat#ER0421
Critical Commercial Assays
RNeasy Mini kit	QIAGEN	Cat#74106
One Step PrimeScript RT-PCR Kit	TaKaRa	Cat#RR064A
Bio-Plex Pro Mouse Cytokine Grp I Panel 23-Plex	BIO-RAD	Cat#M60009RDPD
Reverse transcription (RT)-PCR kit	TaKaRa	Cat#RR096A
NEON 7-color Allround Discovery Kit	Histova Biotechnology	Cat#NEFP750
Experimental Models: Cell Line
Vero Cells	ATCC	Cat#CCL-81
Experimental Models: Animals
C57BL/6	Institute for Laboratory Animal Resources, NIFDC, China	N/A
hACE2-KI/NIFDC	This paper	N/A
Oligonucleotides
sgRNA gaaagatgtccagctcctcctgg	This paper	N/A
Primers for genotyping F0 offspring, see Table S2	This paper	N/A
Primers for RT-qPCR quantification of ACE2 expression level, see Table S2	This paper	N/A
Primers and probes for RT-qPCR quantification of SARS-CoV-2 RNA, see Table S2	This paper	N/A
Software and Algorithms
GraphPad Prism 7.0	Graphpad	https://www.graphpad.com/
Luminex PONENT	Thermo Fisher	https://www.luminexcorp.com/xponent/
Other
IVIS-Lumina II imaging system	Xenogen	https://health.usf.edu/