KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-Olig2 | Millipore | Cat# AB9610; RRID:AB_570666 |
| Guinea Pig anti-Olig2 | Ben Novitch, University of California Los Angeles | N/A |
| Mouse anti-NeuN | Millipore | Cat# MAB377; RRID:AB_2298772 |
| Rabbit anti-NeuN | Millipore | Cat# MABN140; RRID:AB_2571567 |
| Rabbit anti-TCF4/TCF7L2 | Cell Signaling Technology | Cat# 2569; RRID:AB_2199816 |
| Mouse anti-CC1 | Calbiochem | Cat# OP80; RRID:AB_2057371 |
| Rabbit anti-ASPA | Gene Tex | Cat# GTX113389; RRID:AB_2036283 |
| Rabbit anti-Ki67 | Abcam | Cat# ab15580; RRID:AB_443209 |
| Goat anti Sox10 | Santa Cruz | Cat# Sc-17342; RRID:AB_2195374 |
| Chicken anti-GFP | Aves Labs | Cat# GFP-1020; RRID:AB_10000240 |
| Rabbit anti-GFP | Life Technologies | Cat# A11122; RRID:AB_221569 |
| Sheep Anti-Digoxigenin, POD Conjugated | Roche | Cat# 11207733910; RRID:AB_514500 |
| Mouse anti-MBP | Covance | Cat# SMI-99P-100; RRID:AB_10120129 |
| Rat anti-MBP | Milipore | Cat# MAB386; RRID: AB_94975 |
| Mouse anti-beta-Tubulin III | Sigma-Aldrich | Cat# T8578; RRID:AB_1841228 |
| Rabbit anti-GFAP | Agilent | Cat# Z0334; RRID:AB_10013382 |
| Mouse anti-Active-β-Catenin (Anti-ABC) | Millipore | Cat# 05–665; RRID:AB_309887 |
| Mouse anti-Ran | BD Biosciences | Cat# 610341; RRID: AB_397731 |
| Rabbit anti-Cux1 | Proteintech Group | Cat# 11733–1-AP; RRID:AB_2086995 |
| Rat anti-Ctip2 | Abcam | Cat# ab18465; RRID:AB_2064130 |
| Mouse anti-MOG | Millipore | Cat# MAB5680; RRID:AB_1587278 |
| Rabbit anti-Neurofilament H | Millipore | Cat# AB1989; RRID:AB_11212727 |
| Rabbit anti-GDE2 | This study | N/A |
| Mouse anti-Actin | Millipore | Cat# MAB1501; RRID:AB_2223041 |
| Rabbit anti-PDGF receptor alpha | Cell Signaling Technology | Cat# 3174; RRID:AB_2162345 |
| Rabbit anti- β-Catenin | Cell Signaling Technology | Cat# 8480; RRID:AB_11127855 |
| Goat anti-Contactin-2/TAG1 | R and D Systems | Cat# AF4439; RRID:AB_2044647 |
| Mouse anti-Chondroitin Sulfate Proteoglycan (CAT-315) | Millipore | Cat# MAB1581; RRID:AB_94270 |
| Rabbit anti-GAPDH | Cell Signaling Technology | Cat# 8884; RRID:AB_11129865 |
| Goat anti-rabbit IgG (H+K), secondary antibody, FITC and Alexa 647 conjugates | Jackson ImmunoResearch Labs | Cat# 111-095-144; RRID:AB_2337978, Cat# 111-605-144; RRID:AB_2338078 |
| Goat anti-mouse IgG (H+K), secondary antibody, Cy3 and Alexa 488 conjugates | Jackson ImmunoResearch Labs | Cat# 115-165-146; RRID:AB_2338690, Cat# 115-545-166; RRID:AB_2338852 |
| Goat anti-guinea pig IgG (H+K), secondary antibody, Alexa 647 conjugate | Jackson ImmunoResearch Labs | Cat# 106-605-003; RRID:AB_2337446 |
| Donkey anti-goat IgG (H+L), secondary antibody, Cy3 conjugate | Jackson ImmunoResearch Labs | Cat# 705-165-147; RRID:AB_2307351 |
| Donkey anti-chicken IgY (H+L), secondary antibody, Cy3 conjugate | Jackson ImmunoResearch Labs | Cat# 703-165-155; RRID:AB_2340363 |
| Peroxidase Donkey anti-mouse IgG (H+L), secondary antibody | Jackson ImmunoResearch Labs | Cat# 715-035-150; RRID:AB_2340770 |
| Peroxidase Donkey anti-rabbit IgG (H+L), secondary antibody | Jackson ImmunoResearch Labs | Cat# 711-035-152; RRID:AB_10015282 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| (Z)-4-Hydroxytamoxifen | Sigma-Aldrich | Cat# H7904 |
| Sunflower seed oil from Helianthus annuus | Sigma-Aldrich | Cat# S5007 |
| Neurobasal media | GIBCO | Cat# 21103–049 |
| DMEM/F12 media | GIBCO | Cat# 10565–018 |
| Sodium Pyruvate 100mM | GIBCO | Cat# 11360–070 |
| Glutamax | GIBCO | Cat# 35050–061 |
| N2B supplement | STEMCELL Technologies | Cat# 7156 |
| SM1 supplement | STEMCELL Technologies | Cat# 5711 |
| Penicillin-Streptomycin | GIBCO | Cat# 15140–122 |
| Poly-D-lysine hydrobromide | Sigma-Aldrich | Cat# P0899 |
| Laminin | Sigma-Aldrich | Cat# L2020 |
| PureCol Type I Bovine Collagen Solution | Advanced Biomatrix | Cat# 5005-B |
| Forskolin | Calbiochem | Cat# 344270 |
| CNTF | PeproTech | Cat# 450–5 |
| HEPES | GIBCO | Cat# 15630080 |
| N-Acetyl-Cysteine | Sigma-Aldrich | Cat# A8199 |
| DAPI | Invitrogen | Cat# R37606 |
| Protease inhibitor cocktail | Sigma-Aldrich | Cat# P8340 |
| Fluo-4, AM | Thermo Fisher Scientific | Cat# F14201 |
| Ionomycin | Tocris | Cat# 1704 |
| Trizol | Thermo Fisher Scientific | Cat# 15596018 |
| Fast SYBR® Green Master Mix | Thermo Fisher Scientific | Cat# 4385612 |
| Alexa Fluor® 488 Phalloidin | Invitrogen | Cat# A12379 |
| Chondroitinase ABC | Sigma-Aldrich | Cat# C3667 |
| Protein L magnetic beads | Thermo Fisher Scientific | Cat# 88849 |
| Bicuculine | Tocris | Cat# 0131 |
| Critical Commercial Assays | ||
| Neural Tissue Dissociation Kit (P) | Miltenyi Biotec | Cat# 130-092-628 |
| Miltenyi Isolation Starting Kit | Miltenyi Biotec | Cat# 130-090-312 |
| Anti-O4 Microbeads | Miltenyi Biotec | Cat# 130-094-543 |
| SuperScript III | Thermo Fisher Scientific | Cat# 18080051 |
| TSA Plus Cy3 system | PerkinElmer | Cat# NEL744001KT |
| TruSeq® Stranded mRNA LT - Set A | Illumina | Cat# RS-122–2101 |
| RNeasy Plus Micro Kit | QIAGEN | Cat# 74034 |
| NE-PER Nuclear and cytoplasmic extraction reagents | Thermo Fisher Scientific | Cat# 78833 |
| Deposited Data | ||
| RNA-seq data | This study | NCBI’s GEO: GSE147144 |
| Mass spectrometry data | This study | ProteomeXchange: PXD018080 |
| Experimental Models: Cell Lines | ||
| Primary cortical oligodendrocyte progenitor cells | This study | N/A |
| Primary cortical neuronal cells | This study | N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: Gde2KO | Sabharwal et al., 2011 | N/A |
| Mouse: Gde2flox | Sabharwal et al., 2011 | N/A |
| Mouse: PdgfrαCre-ER | Kang et al., 2010 | N/A |
| Mouse: Nex-Cre | Goebbels et al., 2006 | N/A |
| Mouse: Rosa26 Tcf./Lef H2B-EGFP | Cho etal., 2017 | N/A |
| Mouse: Ctnnb1flex3 | Harada et al., 1999 | N/A |
| Oligonucleotides | ||
| Gde2 PCR primers Forward: 5′ CAGAAGGGACCAAGCACTCA 3′ | Sabharwal et al., 2011 | N/A |
| Gde2 PCR primers: Reverse: 5′ CCCGTTGGTTGACATTCGTG 3′ | Sabharwal et al., 2011 | N/A |
| Gde2 in situ hybridization primers: Forward: 5′ CCTCAAGACCGACCCCTT 3′ | Allen brain atlas | http://mouse.brain-map.org/ |
| Gde2 in situ hybridization primers: Reverse: 5′ GGGGCATGATCCAGAGTG 3′ | Allen brain atlas | http://mouse.brain-map.org/ |
| Mbp in situ hybridization primers: Forward: 5′ GAGGCCTGGATGTGATGG 3′ | Allen brain atlas | http://mouse.brain-map.org/ |
| Mbp in situ hybridization primers: Reverse: 5′ GGGGAACAAGTCAGGGCT 3′ | Allen brain atlas | http://mouse.brain-map.org/ |
| Gde2 qPCR primers Forward: 5′ GGCTCCAGAACACACAGTGA 3′ | This study | N/A |
| Gde2 qPCR primers Reverse: 5′ CAGGACAGTCCAGTTGAGCA 3′ | This study | N/A |
| Lef1 qPCR primers: Forward: 5’′ ATGCACGTGAAGCCTCAACA 3′ | Elbazetal., 2016 | N/A |
| Lef1 qPCR primers: Reverse: 5′ AGCTGCACTCTCCTTTAGCG 3′ | Elbazetal., 2016 | N/A |
| Gapdh qPCR primers: Forward: 5′ CGTCCCGTAGACAAAATGGT 3′ | Lebrun-Julien et al., 2014 | N/A |
| Gapdh qPCR primers: Reverse: 5′ TTGATGGCAACAATCTCCAC 3′ | Lebrun-Julien et al., 2014 | N/A |
| Software and Algorithms | ||
| ImageJ/Fiji version 1.52d | National Institutes of Health | https://imagej.nih.gov/ij/index.html |
| Corel Draw X8 | Corel | http://www.corel.com/en/ |
| Adobe Photoshop CC 2017 | Adobe | https://www.adobe.com |
| GraphPad Prism 5 | GraphPad | https://www.graphpad.com/ |
| Imaris | BITPLANE | https://imaris.oxinst.com |
| FastQC | Babraham Bioinformatics | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
| Fqtrim | Johns Hopkins University | https://ccb.jhu.edu/software/fqtrim/ |
| Tophat2 v2.1.1 | Johns Hopkins University | https://ccb.jhu.edu/software/tophat/index.shtml |
| Cufflinks v2.2.1 | Cole Trapnell, University of Washington | http://cole-trapnell-lab.github.io/cufflinks/ |
| Mouse UniProt protein database (released on May 2018) | Uniprot Consortium | https://www.uniprot.org/ |
| MaxQuant v1.5.5.1 | Cox and Mann, 2008 | https://www.biochem.mpg.de/5111795/maxquant |