Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) Background: C57BL/6J |
Tubb4a
Accession number: NM_009451.3 |
Mouse model designed at Cyagen | Mouse Tubb4a Knockin Project (CRISPR/Cas9) with p.Asn249Asn (D249N) mutation | Target region of mouse Tubb4a locus modified and D249N mutation was introduced (Tubb4aD249N/+) |
| Sequence-based reagent | gRNA sequence 1 (Matches forward strand of Tubb4a gene) |
Cyagen designed | CAATGCAGATCTACGCAAGCTGG | |
| Sequence-based reagent | gRNA sequence 2 (Matches reverse strand of Tubb4a gene) |
Cyagen designed | CAATGCAGATCTACGCAAGCTGG | |
| Mouse genotyping And Sequence based reagents |
To identify the genotype of Tubb4aD249N/+ mouse | Taq-Takara | PCR forward and reverse primers and Sequencing | 5’CCGAGAGGAGTTTCCAGACAGACAGGATC3’ 5’GCTCTGCACACTTAACATCTGCTCG 3’ |
| Antibody | anti- PLP (Rat monoclonal) |
IDDRC hybridoma, courtesy Dr. Judith Grinspan | RRID:AB_2827948 | Dilution Used for IF: 1:1 Dilution Used for Western blot: 1:1000 |
| Antibody | anti-MBP (Rabbit polyclonal) |
Abcam | Cat#: ab40389 RRID:AB_1141521 |
Dilution Used for IF: 1:250 Dilution Used for Western blot: 1:1000 |
| Antibody | anti-NG2 (Rabbit polyclonal) |
US biological | Cat#: C5067-70D RRID:AB_2827946 |
Dilution Used for IF: 1:250 |
| Antibody | anti-NG2 (Mouse monoclonal) |
Thermo Fisher Scientific | Cat#: #37–2700 RRID:AB_2533307 |
Dilution Used for IF: 1:100 |
| Antibody | anti-Olig2 (Rabbit polyclonal) |
Millipore | Cat#: MABN50 RRID:AB_10807410 | Dilution Used for IF: 1:100 |
| Antibody | anti-NeuN (Mouse monoclonal) | Millipore | Cat#: MAB377 RRID:AB_2298772 |
Dilution Used for IF: 1:100 |
| Antibody | anti-cleaved Caspase 3 (Rabbit polyclonal) | Cell signaling | Cat#: #9579 RRID:AB_10897512 |
Dilution Used for IF: 1:100 |
| Antibody | anti- Ki-67 (Rabbit polyclonal) |
Thermo Fisher Scientific | Cat#: #RM9106S0 RRID:AB_2341197 | Dilution Used for IF: 1:100 |
| Antibody | anti-calbindin (Rabbit polyclonal) |
Swant | Cat#: CB38 RRID:AB_2721225 | Dilution Used for IF: 1:250 |
| Antibody | anti-A2B5 (Mouse monoclonal) |
IDDRC hybridoma, courtesy Dr. Judith Grinspan | RRID:AB_2827951 | Dilution Used for IF: 1:1 |
| Antibody | anti-MAP2 (Mouse monoclonal) |
Sigma | Cat#: 1406 RRID:AB_477171 |
Dilution Used for IF: 1:200 |
| Antibody | anti-Tuj1 (Mouse monoclonal) |
Abcam | Cat#: ab18207 RRID:AB_444319 |
Dilution Used for IF: 1:200 |
| Transfected construct (Mouse) |
end-binding protein 3 (EB3) -mCherry | Obtained by Dr. Erika Holzbaur | (Guedes-Dias et al., 2019) | |
| qRT-PCR primer | Tubb4a Primers | Integrated DNA Technologies | Custom Designed | Tubb4a primer: Probe: 5’-/5FAM/ATGACCTCC/ZEN/CAGAACTTGGCCC/3IABkFQ /- 3’ Primer 1: 5’GACACCCGTCCATCAGCA3’ Primer 2: 5’GTCGATGCCGTGCTCAT-3’ |
| qRT-PCR primer | sfrs9 Primers | Integrated DNA Technologies | Custom Designed | Probe: 5’-/5HEX/CAGACATCC/ZEN/CCAGCTTCTCGCAT/3IABkFQ /- 3’ Primer 1: 5’TTCAACCATCCCCATTCCG-3’ Primer 2: 5’CCTCCTACAACAAGACGGTCAGAT-3’ |
| Software | Graphpad Prism | Graphpad Prism | Graphpad Prism 9 RRID:SCR_002798 |
|
| Other | DAPI stain | Invitrogen | Cat#: P36931 | 1 µg/mL |