An official website of the United States government
Here's how you know
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Table III. The retrieved sequences from the fastq file of the RNA sequencing using the “grep” command and the search term “ATTGGCCAAAATGGGAAGGA” which is the first 20 nt in the exon 3 of PLAG1 to nt 286-305 in the PLAG1 reference sequence with the accession number NM_002655.2.