Skip to main content
. 2020 May 3;17(3):237–248. doi: 10.21873/cgp.20184

Table III. The retrieved sequences from the fastq file of the RNA sequencing using the “grep” command and the search term “ATTGGCCAAAATGGGAAGGA” which is the first 20 nt in the exon 3 of PLAG1 to nt 286-305 in the PLAG1 reference sequence with the accession number NM_002655.2.

graphic file with name cgp-17-242-i0001.jpg