Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Monoclonal rat anti-alpha tubulin (tyrosinated) | MilliporeSigma | Millipore Cat# MAB1864, RRID:AB_2210391 | IHC (1:500) |
| Antibody | Monoclonal mouse anti-alpha tubulin (acetylated) | Sigma-Aldrich | Sigma-Aldrich Cat# T6793, RRID:AB_477585 | IHC (1:500) |
| Antibody | Monoclonal rat anti-Ecadherin | DSHB | DSHB Cat# DCAD2, RRID:AB_528120 | IHC (1:500) |
| Antibody | Monoclonal mouse anti-Fasciclin III | DSHB | DSHB Cat# 7G10 anti-Fasciclin III, RRID:AB_528238 | IHC (1:500) |
| Antibody | Polyclonal rabbit anti-histone H3 (phospho S10) | Abcam | Abcam Cat# ab5176, RRID:AB_304763 | IHC (1:50) |
| Antibody | Polyclonal goat anti-GFP | Abcam | Abcam Cat# ab6662, RRID:AB_305635 | IHC (1:300) |
| Lectin | fluoresceinVicia Villosa Lectin (VVA) | Vector Laboratories | Vector Laboratories Cat# FL-1231, RRID:AB_2336856 | IHC (1:200) |
| Chemical compound, drug | rhodamine phalloidin | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# R415, RRID:AB_2572408 | IHC (1:200) |
| Strain, strain background (Drosophila melanogaster) | y1w1Drosophila melanogaster | BloomingtonDrosophilaStock Center | BDSC Cat# 1495, RRID:BDSC_1495 | |
| Strain, strain background (Drosophila biarmipes) | wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #:14023–0361.10 RRID:FlyBase_FBst0203870 |
|
| Strain, strain background (Drosophila ananassae) | wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #:14024–0371.13 RRID:FlyBase_FBst0201380 |
No longer available |
| Strain, strain background (Drosophila pseudoobscura) | wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #:14011–0121.87 RRID:FlyBase_FBst0200074 |
No longer available |
| Strain, strain background (Drosophila sechellia) | Wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #: #14021–0248.03 RRID:FlyBase_FBst0201190 |
No longer available |
| Genetic reagent (Drosophila melanogaster) | UAS-Raeppli-CAAX | Bloomington Drosophila
Stock Center (BDSC) |
BDSC Cat# 55084, RRID:BDSC_55084 | |
| Genetic reagent (Drosophila melanogaster) | Pox neuro-Gal4 | (Boll and Noll, 2002) | Construct #13 | |
| Genetic reagent (Drosophila melanogaster) | D. simulans Pox neuro-Gal4 | This paper | Can be obtained from Mark Rebeiz,rebeiz@pitt.edu | |
| Genetic reagent (Drosophila melanogaster) | hs – flippase122 | Gift from Erika A. Bach | Flybase: FBtp0001101 | |
| Genetic reagent (Drosophila melanogaster) | armadillo-GFP | (Huang et al., 2012) | ||
| Genetic reagent (Drosophila melanogaster) | Dumpy:YFP | Drosophila Genomics and Genetic Resources | DGGR Cat# 115238, RRID:DGGR_115238 | |
| Genetic reagent (Drosophila melanogaster) | Viking:GFP | Drosophila Genomics and Genetic Resources | DGGR Cat# 110626, RRID:DGGR_110626 | |
| Genetic reagent (Drosophila melanogaster) | Perlecan:GFP | Drosophila Genomics and Genetic Resources | DGGR Cat# 110807, RRID:DGGR_ 110807 | |
| Genetic reagent (Drosophila melanogaster) | E-cadherin:mCherry | Bloomington Drosophila stock center | BDSC Cat# 59014, RRID:BDSC_59014 | |
| Genetic reagent (Drosophila melanogaster) | UAS-dumpyRNAi | ViennaDrosophilaResource Center | VDRC Cat#44029, RRID:FlyBase_FBst0465370 | |
| Genetic reagent (Drosophila melanogaster) | UAS-mCherryRNAi | Bloomington Drosophila stock center | BDSC Cat# 35785, RRID:BDSC_35785 | |
| Recombinant DNA reagent |
pS3aG4 | Gift from Benjamin Prud'homme | Gal4 vector used to make D. simulans Pox neuro gal4 line | |
| Sequence-based reagent | GCCACTAACAATCCATGCGGTT | This paper | dumpy probe forward primer. Obtained from Integrated DNA Technologies. | |
| Sequence-based reagent | TAATACGACTCACTATAGGGAGAAATAGCCCTGTCCTTGGAATCC | This paper | dumpy probe reverse primer with T7 primer. Obtained from Integrated DNA Technologies. | |
| Sequence-based reagent | TTCCGGGCGCGCCTCGGTGGCTTAACACGCGCATT | This paper | D. simulans Pox neuro forward primer for gal four line. Obtained from Integrated DNA Technologies. | |
| Sequence-based reagent | TTGCCCCTGCAGGATCGCTGATTCCATGGCCCAGT | This paper | D. simulans Pox neuro reverse primer for gal four line. Obtained from Integrated DNA Technologies. | |
| Software algorithm | Fiji (ImageJ v2.0) | (Schindelin et al., 2012) | RRID:SCR_002285 | |
| Software algorithm | GenePalette | (Rebeiz and Posakony, 2004; Smith et al., 2017) | ||
| Software algorithm | Leica Application Suite X | Leica | RRID:SCR_013673 | |
| Software algorithm | Microsoft Excel | Microsoft | RRID:SCR_016137 | |
| Software algorithm | MorphoGraphX | (Barbier de Reuille et al., 2015) | ||
| Software algorithm | Prism 8 | GraphPad | RRID:SCR_002798 |