Table 1.

The sequences of the primers designed for the S and N genes, the predicted RT‐PCR product size and their positions in genes S and N

Target gene	Primer	Sequence (5′−3′)	Position	Product length	Reference no.
Nucleocapsid	BCV‐N‐f	GCCGATCAGTCCGACCAATC	29475–29494	407	Masaharu et al (2012)
Nucleocapsid	BCV‐N‐R	AGAATGTCAGCCGGGGTAT	29881–29863
S	S1AF a	5’‐ATG TTT TTG ATA CTT TTA ATT−3’	1–21	633	Hasoksuz et al. (2002); Liu et al. (2006)
S	S1AR b	5’‐AGT ACC ACC TTC TTG ATA AA−3’	654–635

The sequences of primers, the predicted RT‐PCR product size, the sequences of primers of gene S and its position in gene S.

^aF: upstream primer.

^bR: downstream primer.