Skip to main content
. 2020 Jun 2;28(6):674–689.e11. doi: 10.1016/j.str.2020.04.010
REAGENT or RESOURCE Source Identifier
Antibodies
Rabbit anti-ARL13B Proteintech 17711-1-AP
Mouse anti-alpha-tubulin Sigma-Aldrich T9026
Rabbit anti-acetylated-alpha-tubulin Abcam ab179484
Mouse anti-gamma-tubulin Sigma-Aldrich T6557
Chicken anti-GFP Abcam ab13970
Mouse anti-GFP Thermo Fisher Scientific A11120
Rabbit anti-HA Gift from Dr Manu Hedge N/A
Rat anti-HA Roche 118674230001
Mouse anti-centrin Gift from Dr Jeffrey L. Salisbury N/A
Mouse anti-centrin 3 Abnova H00001070-M01
Bacterial Strains
BL21(DE3) New England Biolabs C2527
C41(DE3) Miroux and Walker, 1996 N/A
Rosetta (DE3) Gift from Dr John Kilmartin N/A
Chemicals, Peptides, and Recombinant Proteins
D-MEM Glutamax Thermo Fisher Scientific Catalog # 10566016
D-MEM/F-12, supplied, GlutaMAX, sodium carbonate Thermo Fisher Scientific Catalog # 31331028
D-MEM/F-12 without phenol red Thermo Fisher Scientific Catalog # 21041025
Opti-MEM Thermo Fisher Scientific Catalog # 31985062
CloneAmp HiFi Premix Clontech Catalog # 639298
In-Fusion HD cloning Clontech Catalog # 638933
RNeasy Mini Kit Qiagen Catalog # 74104
RNase-free DNase I Thermo Fisher Scientific Catalog # EN0521
SuperScript IV VILO Master Mix Thermo Fisher Scientific Catalog # 11756050
QuickExtract DNA extract solution Cambio Catalog # QE0950
0.1% poly-L-Lysine Sigma-Aldrich Catalog # P8920
Ni-NTA resin Expedeon Catalog # ANN0100
Ni-NTA Qiagen Catalog # 30210
Glutathione sepharose 4B GE Healthcare Life Sciences Catalog # 17075601
NHS-activated sepharose 4 Fast Flow GE Healthcare Life Sciences Catalog # 17090601
Tev protease Homemade N/A
GST-PreScission protease Homemade N/A
Tubulin Gift from Dr Andrew Carter N/A
Subtilisin A Sigma-Aldrich Catalog # P5380
Monastrol Sigma-Aldrich Catalog # M8515
ProLong Diamond Antifade Mountant Thermo Fisher Scientific Catalog # P36970
Fluoromount-G Southern Biotech Catalog # 0100-01
Hoechst 33342 EMP Biotech Catalog # F-0409
PEI Polysciences Catalog # 24765
Lipofectamine 3000 Thermo Fisher Scientific Catalog # L3000001
Lipofectamine RNAiMAX Thermo Fisher Scientific Catalog # 13778150
Deposited Data
Human XRCC4-DNA Ligase IV complex Sibanda et al., 2001 PDB code: 1IK9
Human XLF Li et al., 2008 PDB code: 2QM4
Human XRCC4-XLF complex Wu et al., 2011 PDB code: 3W03
The N-terminal head domain of zebrafish SAS6 van Breugel et al., 2011 PDB code: 2Y3V
N-terminal head domain and beginning of coiled coil domain of Zebrafish SAS6 van Breugel et al., 2011 PDB code: 2Y3W
N-terminal domain of C. elegans SAS6 Hilbert et al., 2013 PDB code: 3PYI
N-terminal fragment of L. major SAS6 van Breugel et al., 2014 PDB code: 4CKP
Human PAXX Ochi et al., 2015 PDB code: 3WTD
hCCCDC611-143 structure This paper PDB code: 6HXT
zCCCDC611-168; F129E/D130A structure This paper PDB code: 6HXV
zCCCDC611-170 structure This paper PDB code: 6HXY
Experimental Models: Cell Lines
HEK293T ATCC ATCC: CRL-3216
RPE-1 Gift from Prof. Colin A. Johnson N/A
RPE-1 PuroKO Balmus et al., 2019 N/A
RPE-1 CCDC61 KO clone 1 and 2 this paper N/A
Experimental Models: Organisms/Strains
vfl3-1 Chlamydomonas Resource Center CC-1686
vfl3-2 this paper N/A
Oligonucleotides
siRNA 1 Thermo Fisher Scientific siRNA ID: s59736
siRNA 2 Thermo Fisher Scientific siRNA ID: s59737
siRNA 3 Thermo Fisher Scientific siRNA ID: s59738
Control siRNA Thermo Fisher Scientific siRNA ID: 4390084
hCCDC61 knockout target sequence 1: GGAAGACGTAGTCCACCTGCAGG This paper N/A
hCCDC61 knockout target sequence 2: GGAGCATGCCGTGCGGGTGATGG This paper N/A
RT-PCR primer forward: TGCAGCGATTTGGAGGATTT This paper N/A
RT-PCR primer reverse: CGGAGTTGGCCAGAGATTTC This paper N/A
Primers used for site-directed mutagenesis of human and zebrafish CCDC61, and human genomic DNA PCR in Table S2 N/A N/A
Primers used to amplify Chlamydomonas VFL3 are listed in Table S3 N/A N/A
Recombinant DNA
hCCDC61 Synthesized by GenScript UniProt: Q9Y6R9
zCCDC61 Source BioScience IMAGE ID: 7406569. UniProt: Q08CF3
xCCDC61 Synthesized by Thermo Fisher Scientific NCBI accession number: XP_018084688.1
PAXX Ochi et al., 2015 N/A
GFP nanobody Synthesized by GenScript N/A
pGAT3-hCCDC611-143 this paper N/A
pGAT3-hCCDC611-143; F128E/D129A this paper N/A
pSKB2LNB-zCCDC611-168; F129E/D130A this paper N/A
Lipo-zCCDC611-170 this paper N/A
Lipo-zCCDC611-170; F129E/D130A this paper N/A
pSKB2LNB-zCCDC61146-280 this paper N/A
pSKB2LNB-zCCDC61146-280; 5E this paper N/A
pSKB2LNB-PAXX1-137-hCCDC61144-287 this paper N/A
pSKB2LNB-PAXX1-137-hCCDC61144-287; 5E this paper N/A
pSKB2LNB-hSAS61-143 this paper N/A
pHAT5-GFP-nonobody this paper N/A
short-VFL3-TOPO this paper N/A
WT-VFL3-TOPO this paper N/A
pEGFP-C1-hCCDC61 this paper N/A
pEGFP-C1-hCCDC61F128E/D129A this paper N/A
pEGFP-C1-hCCDC61144-287-NES this paper N/A
pEGFP-C1-hCCDC61288-512 this paper N/A
pEGFP-C1-hCCDC611-457; F128E/D128A this paper N/A
pEGFP-C1-hCCDC611-457; F128E/D129A/5E this paper N/A
pcDNA3-3xHA-hCCDC611-457; F128E/D128A this paper N/A
pcDNA3-3xHA-hCCDC611-457; F128E/D129A/5E this paper N/A
pENTR-D-TOPO-xCCDC61 this paper N/A
pCS2+-xCCDC61-RFP this paper N/A
pCS2+-Centrin2-BFP this paper N/A
pCS2+-Clamp-GFP Park et al., 2008 N/A
AIO-GFP-hCCDC61 this paper N/A
pGAT3 Peränen et al., 1996 Addgene: 112589
pHAT4 Peränen et al., 1996 Addgene: 112585
pHAT5 Peränen et al., 1996 Addgene: 112586
pSKB2LNB Fekairi et al., 2009 N/A
pcEGFP-C1 Clontech Catalog # 6084-1
pcDNA3 Invitrogen Catalog # A-150228
AIO-GFP Chiang et al., 2016 Addgene: 74119
pENTR-D-TOPO Thermo Fisher Scientific Catalog # K240020
pCR2.1-TOPO Thermo Fisher Scientific Catalog # K455001
Software and Algorithms
Jpred Drozdetskiy et al., 2015 http://www.compbio.dundee.ac.uk/jpred/
BackPhyre Kelly and Sternberg, 2009 http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index
HHPred Söding et al., 2005 https://toolkit.tuebingen.mpg.de/tools/hhpred
PSI-BLAST Altschul et al., 1997 https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE=Proteins&PROGRAM=blastp&RUN_PSIBLAST=on
MUSCLE Edgar, 2004 https://www.drive5.com/muscle/
BOXSHADE N/A https://embnet.vital-it.ch/software/BOX_form.html
SIAS server N/A http://imed.med.ucm.es/Tools/sias.html
SeaView Gouy et al., 2010 http://doua.prabi.fr/software/seaview
PhyML Guindon et al., 2010 http://www.atgc-montpellier.fr/phyml/
FigTree N/A http://tree.bio.ed.ac.uk/software/figtree/
Modeller Sali and Blundell, 1993 https://salilab.org/modeller/
TopMatch Sippl and Wiederstein, 2012 https://topmatch.services.came.sbg.ac.at/
XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/
CCP4 program suite Winn et al., 2011 https://www.ccp4.ac.uk/ccp4i_main.php
iMOSFLM Battye et al., 2011 Run from CCP4 program suite
Aimless Evans, 2011 Run from CCP4 program suite
PHENIX suite Adams et al., 2010 https://www.phenix-online.org/
MolProbity Run from PHENIX suite
Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
PyMOL N/A https://pymol.org/2/
Consurf Glaser et al., 2003 https://consurf.tau.ac.il/
SEDFIT Schuck, 2003 http://www.analyticalultracentrifugation.com/sedfit.htm
Sedntrep Dr Tomas Laue, University of New Hampshire N/A
SEDPHAT Schuck, 2003 http://www.analyticalultracentrifugation.com/sedphat/default.htm
GUSSI Brautigam, 2015 http://biophysics.swmed.edu/MBR/software.html
Topspin Bruker N/A
SPARKY T. D. Goddard and D. G. Kneller, University of California https://www.cgl.ucsf.edu/home/sparky/
CRISPR DESIGN Hsu et al., 2013 No longer available
LAS X Leica N/A
Zen Zeiss N/A
Volocity Perkin Elmer N/A
Fiji Schindelin et al., 2012 https://imagej.net/Fiji/Downloads
Photoshop Adobe N/A
Huygens Professional Scientific Volume Imaging N/A
FCS EXPRESS 6 De Novo Software N/A
Prism GraphPad N/A
Social Science Statistics N/A https://www.socscistatistics.com/tests/chisquare/
Other
GSTrap FF 16/10 GE Healthcare Life Sciences Catalog # 28936550
GSTrap HP GE Healthcare Life Sciences Catalog # 17528202
HisTrap HP GE Healthcare Life Sciences Catalog # 17524801
HisTrap FF GE Healthcare Life Sciences Catalog # 17525501
HiTrap Q HP GE Healthcare Life Sciences Catalog # 17115401
HiTrap Q FF GE Healthcare Life Sciences Catalog # 17515601
HiTrap Heparin HP GE Healthcare Life Sciences Catalog # 17040701
PD-10 desalting column GE Healthcare Life Sciences Catalog # 17085101
Superdex 75 16/600 GE Healthcare Life Sciences Catalog # 28989333
Superdex S200 10/300 GE Healthcare Life Sciences Catalog # 17517501
16 Chambered cover glass Grace Bio-Labs Catalog # 112358
Multi-spot slide Thermo Fisher Scientific Catalog # 9991090
400 mesh carbon-coated copper grids Electron Microscopy Sciences Catalog # CF400-Cu-50