REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-NDUFA9 (Complex I)	Invitrogen, Thermo Fisher Scientific	Cat# 459100; RRID: AB_2532223
Anti-NDUFB8 (Complex I)	Invitrogen, Thermo Fisher Scientific	Cat# 459210; RRID: AB_2532232
Anti-Complex II 70 kDa Fp Subunit	Invitrogen, Thermo Fisher Scientific	Cat# 459200; RRID: AB_2532231
Anti-UQCRC1 (Complex III)	Invitrogen, Thermo Fisher Scientific	Cat# 459140; RRID: AB_2532227
Anti-Subunit Va (Complex IV)	Invitrogen, Thermo Fisher Scientific	Cat# 459110; RRID: AB_2532224
Anti-ATP synthase subunit β (Complex V)	Invitrogen, Thermo Fisher Scientific	Cat# 21351; RRID: AB_221512
Anti-calnexin	Merck Millipore	Cat# 208880; RRID: AB_2069031
Anti-GLUT-1	Merck Millipore	Cat# 07-1401; RRID: AB_1340
Anti-pGLUT-1 (Ser-226)	Merck Millipore	Cat# ABN991
Anti-TOM20	Cell Signaling	Cat# sc-11415; RRID: AB_2207533
Anti-GFAP	Abcam	Cat# 7260; RRID: AB_305808
Anti-Akt	Cell Signaling	Cat# 4685; RRID: AB_2225340
Anti-pAkt (S473)	Cell Signaling	Cat# 4060; RRID: AB_2315049
Anti-FGF21	R&D Systems	Cat# AF3057; RRID: AB_2104611
Anti-IgG Control	R&D Systems	Cat# AB-108-C; RRID: AB_354267
Anti-GLP-1R	Novus Biologicals	Cat# NBP1-97308; RRID: AB_11139100
Anti-GFP	Abcam	Cat# 13970; RRID: AB_300798
Anti-TH	Abcam	Cat# 76442; RRID: AB_1524535
Alexa 488 donkey-anti-rabbit	Thermo Fisher Scientific	Cat# A-21206; RRID: AB_2535792
Alexa 488 goat-anti-rabbit	Thermo Fisher Scientific	Cat# A-11008; RRID: AB_143165
FITC goat-anti-chicken	Jackson Laboratories	Cat# 103-095-155; RRID: AB_2337384
Alexa 647 donkey-anti-rabbit	Thermo Fisher Scientific	Cat# A-31573; RRID: AB_2536183
Alexa 633–conjugated streptavidin	Invitrogen, Thermo Fisher Scientific	Cat# S-21375; RRID: AB_2313500
Dylight 488 anti-chicken IgG	Abcam	Cat# 96947; RRID: AB_10681017
Bacterial and Virus Strains
AAV5-GFAP(2.2)-iCre	Vector BioLabs	VB1172
AAV5-GFAP(2.2)-eGFP	Vector BioLabs	VB1180
Chemicals, Peptides, and Recombinant Proteins
AdenoBOOST	Sirion Biotech	Cat# SB-P-AV-101-02
Biocytin	Sigma-Aldrich	Cat# B4261
DAPI-containing vectashield	Vector Laboratories	Cat# VEC-H-1200
GLP-1 7-36 amide	Bachem	Cat# H-6795
WZB117	Sigma Aldrich	Cat# SML0621
20% Glucose	bela-pharm	Cat# 2069.97.99
Insulin	Sanofi Aventis, Germany	Insuman rapid
Liraglutide594	Novo Nordisk	N/A
Seahorse XF Palmitate-BSA FAO Substrate	Agilent Technologies	Cat# 102720-100
Tamoxifen	Sigma-Aldrich	Cat# T5648-5G
TSA Plus Cyanine 3	Perkin Elmer	Cat# NEL744E001KT
TSA Plus Cyanine 5	Perkin Elmer	Cat# NEL745E001KT
Chemicals used in Primary Cell Cultures
DMEM high glucose, GlutaMAX	GIBCO, ThermoFisher Scientific	Cat# 10569010
DMEM	GIBCO, ThermoFisher Scientific	Cat# 11966-025
Fetal Bovine Serum (FBS)	Pan Biotech	Cat# P30-3302
Penicillin/Streptomycin	GIBCO, ThermoFisher Scientific	Cat# 15140-122
HBSS, no calcium, no magnesium	Invitrogen, ThermoFisher Scientific	Cat# 14170112
L-15 medium	GIBCO, ThermoFisher Scientific	Cat# 11415064
D-(+)-Glucose solution 45% in H2O	Sigma-Aldrich	Cat# G8769
L-Carnitine hydrochloride	Sigma-Aldrich	Cat# C0283-1G
Etomoxir	Sigma-Aldrich	Cat# E1905-25MG
HEPES solution	Sigma-Aldrich	Cat# H0887-100ML
Poly-L-Lysine	Sigma-Aldrich	Cat# P-4707
Critical Commercial Assays
QIAshredder (250)	QIAGEN	Cat# 79656
RNeasy Mini Kit (250)	QIAGEN	Cat# 74106
Applied Biosystems High-Capacity CDNA Reverse Transcription Kit	Thermo Fisher Scientific	Cat# 4368813
Applied Biosystems TaqMan Universal PCR Master Mix	Thermo Fisher Scientific	Cat# 10733457
Mouse GLP-1 ELISA	Crystal Chem, USA	Cat# 81508
Mouse ultra-sensitivity insulin ELISA	Crystal Chem, USA	Cat# 90080
Human Ultrasensitive Insulin ELISA	DRG Instruments GmbH	Cat# EIA-2337
Mouse Leptin ELISA	Crystal Chem, USA	Cat# 90030
Picoprobe Glucose Assay	Abcam	Cat# ab169559
Glucose Uptake Cell-Based Assay	Cayman Chemical, USA	Cat# Cay-600470
Pierce BCA Protein Assay	Thermo Fisher Scientific	Cat# 23225
L-Lactate Assay	Abcam	ab65331
Dental acrylic Super Bond C&B	Sun Medical	Cat# 7100
XF Cell Mito Stress Test Kit	Agilent Technologies	Cat# 101706-100
TSA Plus Fluorescence kit	Perkin Elmer, USA	Cat# NEL741001KT
RNAscope Enhancer Fluorescent Kit v2	ACD	Cat# 323100
Experimental Models: Organisms/Strains
Mouse: C57BL/6N	Charles River	N/A
Mouse: hGFAP-CreERT2	(Ganat et al., 2006)	N/A
Mouse: GLP-1R-flox	(Jun et al., 2014)	N/A
Mouse: GLP-1R deficient (GLP-1RΔ/Δ)	(Scrocchi et al., 1996)	N/A
Mouse: FGF21-flox	(Potthoff et al., 2009)	N/A
Oligonucleotides
Taqman probe mGLP1-R	ThermoFisher Scientific	Mm00445292_m1
Taqman probe HPRT	ThermoFisher Scientific	Mm01545399_m1
Taqman probe ATF4	ThermoFisher Scientific	Mm00515324_m1
Taqman probe ATF5	ThermoFisher Scientific	Mm04179654_m1
Taqman probe Ddit3 (CHOP)	ThermoFisher Scientific	Mm00492097_m1
Taqman probe Hspa5 (BIP)	ThermoFisher Scientific	Mm00517691_m1
Taqman probe Ppara (PPARα)	ThermoFisher Scientific	Mm00440939_m1
Taqman probe FGF21	ThermoFisher Scientific	Mm00840165_g1
Custom-designed qPCR probes targeting hGLP1-R construct: Flag primer 5′ 913: GGACTACAAGGATGACGACGAC, 3′ 3580-152: CCCAAGGCACACAAAA AACC and mUTRprobe: 5′ FAM TGGCCATCCCAGGTGGGAGAGA TCCT 3′TAMRA	Eurogentec	https://secure.eurogentec.com/life-science.html
mitochondrial Nd2: fw: 5′- AGGG ATCCCACTGCACATAG-3′; rev: 5′- CTCCTCATGCCCCTATGAAA-3′	Eurogentec	https://secure.eurogentec.com/life-science.html
mitochondrial D-Loop: fw: 5′- GGTTC TTACTTCAGGGCCATCA-3′, rev: 5′- GATTAGACCCGATACCATCGAGAT-3′	Eurogentec	https://secure.eurogentec.com/life-science.html
nuclear Nduv: fw: 5′- CTTCCC CACTGGCCTCAAG-3′; rev: 5′- CCAAAACCCAGTGATCCAGC-3′	Eurogentec	https://secure.eurogentec.com/life-science.html
Custom-designed RNA scope probe targeting the region 108 - 1203 of the GLP1R transcript	ACD	Cat# NM_021332.2
Custom-designed RNA scope probe targeting the region 5 - 904 of the FGF21 transcript	ACD	Cat# NM_020013.4
Software and Algorithms
GraphPad Prism 6 and 7	GraphPad	https://www.graphpad.com/scientific-software/prism/
Fiji (ImageJ) Software Package (incl. Adiposoft Plugin)	(Schneider et al., 2012)	https://imagej.net/Adiposoft
IVIS LivingImage Software V4.3.1	Caliper LifeScience, Perkin Elmer, USA	https://www.perkinelmer.de/category/in-vivo-imaging-software
Vinci software package 4.61.0	(Cízek et al., 2004)	https://vinci.sf.mpg.de/
TargetLynx Software	Waters	https://www.waters.com/waters/library.htm?locale=en_US&lid=1545580
Wave Desktop	Agilent Technologies	https://www.agilent.com/en/products/cell-analysis/cell-analysis-software/data-analysis/wave-desktop-2-6
PatchMaster (version 2.32)	HEKA, Lambrecht, Germany	https://www.heka.com/downloads/downloads_main.html
Patcher’s Power Tools plug-in	MPI, Neher Lab; programmed in IGOR Pro 6, Wavemetrics, Lake Oswego, OR, USA	https://www.mpibpc.mpg.de/groups/neher/index.php?page=software
CED 1401 with Spike2 (version 7)	Cambridge Electronic Design Ltd., Cambridge, UK	http://ced.co.uk/de/
Other
Regular Chow Diet	sniff Spezialdiäten GmbH, Germany	R/M-H phytoestrogen-low
IVIS Spectrum CT scanner	Caliper LifeScience, Perkin Elmer, USA	Cat# 128201
Indirect calorimetry system ‘‘PhenoMaster’’	TSE systems, Chesterfield, USA	http://www.tse-systems.com/products/metabolism/home-cage/phenomaster/index.htm
XFe96 Extracellular Flux Analyzer, “Seahorse”	Agilent Technologies	https://www.agilent.com/en/products/cell-analysis/seahorse-analyzers/seahorse-xfe96-analyzer
Inveon preclinical PET/CT system	Siemens	N/A
Dionex ICS-6000 HPIC system	Thermo Fisher Scientific	https://www.thermofisher.com/de/de/home/industrial/chromatography/ion-chromatography-ic/ion-chromatography-systems/modular-ic-systems.html
Vibrating Microtome VT1200s	Leica Microsystems	https://www.leicabiosystems.com/histology-equipment/sliding-and-vibrating-blade-microtomes/vibrating-blade-microtomes/leica-vt1200-s/
Leica TCS SP-8-X Confocal microscope	Leica Microsystems	https://www.leica-microsystems.com/products/confocal-microscopes/p/leica-tcs-sp8-x/
AB-QuantStudio 7 Flex	Applied Biosystems, Thermo Fischer Scientific	Cat# 4485701
Inline solution heater	Warner Instruments, Hamden, CT, USA	Cat# SH27B
Temperature controller	Warner Instruments, Hamden, CT, USA	Cat# TC-324B
Electrode glass	Science Products	Cat# GB150-8P
Vertical pipette puller	Narishige, London, UK	Cat# PP-830
EPC10 patch-clamp amplifier	HEKA, Lambrecht, Germany	https://www.heka.com/