Skip to main content
. 2020 May 20;21(10):3619. doi: 10.3390/ijms21103619

Figure 1.

Figure 1

(A) Illustration of the applied functionalization of (10,0) carbon nanotube. (B) Schematic representation of the molecular topology of the guanine functional group attached to the CNT tip. (C) Doxorubicin molecule in its protonated form. (D) iMu - the telomeric fragment of ssDNA consisting of the sequence CCCTAACCCTAACCCTAACCCT in the radom coil form. (E) iMp - the fragment of ssDNA with semiprotonated cytosines CCCTAACCCTAAC+C+C+TAAC+C+C+T in the form of i-motif. (F) Triplet of hydrogen bonds formed between protonated C+ and unprotonated cytosines C within the iMp structure.