Skip to main content
. 2020 May 25;21(10):3727. doi: 10.3390/ijms21103727

Table 1.

Sequences of the protospacers designed in the study and positions of the corresponding regions in the Lichtheimia corymbifera pyrG gene.

Designation Sequence (5′–3′) Position in the pyrG Gene
LcpyrGcr1 acacgactttatgatattcg 315–334 1
LcpyrGcr2 aatgaacgaacacgacgatg 687–707

1 Numbers present nucleotide positions downstream from the start codon of the L. corymbifera pyrG gene (gene ID: ID: LCOR_02455.1).