Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of upstream and downstream primer sequences.
| Primer Name | Sequence (5′–3′) |
|---|---|
| Homo U6 Forward primer | AGAGAAGATTAGCATGGCCCCTG |
| hsa-miR-378b Forward primer | GCGCGACTGGACTTGGAG |
| hsa-miR-378g Forward primer | CGCGACTGGGCTTGGAGT |
| General Reverse primer | AGTGCAGGGTCCGAGGTATT |
