Skip to main content
. 2020 May 5;9:e55863. doi: 10.7554/eLife.55863

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional
information
Antibody Anti- digoxigenin-POD, sheep, polyclonal Fab fragments Sigma-Aldrich, Rouche Roche, Cat# 11207733910, RRID:AB_514500 1:3000
Sequence-based reagent cFos _F This paper PCR primers CCGATACACTGCAAGCTGAA
Sequence-based reagent cFos_R This paper PCR primers ATTGCAGGGCTATGGAAGTG
Peptide, recombinant protein Proteinase K Sigma-Aldrich Cat# P6556-10MG 2 mg/ml
Commercial assay TSA Plus Cyanine three system Sigma-Aldrich, Perkin Elmer Cat# NEL74401KT Dilution 1:50
Chemical compound, drug Buspirone hydrochloride Sigma-Aldrich Cat# B7148-1G 30 uM and 50 uM
Software, algorithm Anaconda, Spyder Anaconda (https://www.anaconda.com/) Spyder, RRID:SCR_017585 Version 4.0.1
Software ImageJ NIH
(http://imagej.nih.gov/ij/)
RRID:SCR_003070
Software ANTs- Advanced Normalisation Tools http://stnava.github.io/ANTs/ RRID:SCR_004757 Version 2.1.0
Other DAPI staining Sigma-Aldrich Cat#
D9564-10MG
1 mg/ml
Other Slc6a4b RNA probe Norton et al., 2008
Other DAT RNA probe Filippi et al., 2010
Other Th1 RNA Probe Filippi et al., 2010
Other Th2 RNA probe Filippi et al., 2010