Key resources table.
Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
---|---|---|---|---|
Gene (herpes simplex virus 1) | UL7 | Human herpesvirus 1 strain KOS, complete genome | GenBank: JQ673480.1; UniProt: A0A110B4Q7 | |
Gene (herpes simplex virus 1) | UL51 | Human herpesvirus 1 strain KOS, complete genome | GenBank: JQ673480.1; UniProt: D3YPL0 | |
Gene (varicella zoster virus) | ORF53 | Human herpesvirus 3 (HHV-3), complete genome, isolate HJ0 | GenBank: AJ871403.1; Uniprot: P09301 | |
Gene (varicella zoster virus) | ORF7 | Human herpesvirus 3 (HHV-3), complete genome, isolate HJ0 | GenBank: AJ871403.1; Uniprot: P09271 | |
Gene (human cytomegalovirus) | UL103 | Human herpesvirus 5 strain Toledo, complete genome | GenBank: GU937742.2; Uniprot: D3YS25 | |
Gene (human cytomegalovirus) | UL71 | Human herpesvirus 5 strain Toledo, complete genome | GenBank: GU937742.2; Uniprot: D3YRZ9 | |
Gene (Kaposi’s sarcoma-associated herpesvirus) | ORF42 | Human herpesvirus 8 strain JSC-1 clone BAC16, complete genome | GenBank: GQ994935.1; Uniprot: F5HAI6 | |
Gene (Kaposi’s sarcoma-associated herpesvirus) | ORF55 | Human herpesvirus 8 strain JSC-1 clone BAC16, complete genome | GenBank: GQ994935.1; Uniprot: F5H9W9 | |
Strain, strain background (Escherichia coli) | T7 express lysY/Iq | New England BioLabs | Cat#: C2566H | |
Cell line (Homo sapiens) | HEK 293 T | ATCC | Cat#: CRL-3216; RRID:CVCL_0063 | |
Cell line (Homo sapiens) | HeLa | ATCC | Cat#: CCL-2; RRID:CVCL_0030 | |
Antibody | Anti-GFP (rabbit polyclonal) | Merck | Cat#: G1544; RRID:AB_439690 | (1:5000) |
Antibody | Anti-RFP (rat monoclonal) | Chromotek | Cat#: 5F8; RRID:AB_2336064 | (1:1000) |
Antibody | Anti-GAPDH (mouse monoclonal) | ThermoFisher | Cat#: AM4300; RRID:AB_2536381 | (1:200,000) |
Antibody | IRDye 680T conjugated goat anti-rat (polyclonal) | LI-COR | Cat#: 926–68029; RRID:AB_10715073 | (1:10,000) |
Antibody | IRDye 680T conjugated donkey anti-rabbit (polyclonal) | LI-COR | Cat#: 926–68023; RRID:AB_10706167 | (1:10,000) |
Antibody | IRDye 680T conjugated goat anti-mouse (polyclonal) |
LI-COR | Cat#: 926–68020; RRID:AB_10706161 | (1:10,000) |
Antibody | IRDye 800CW conjugated donkey anti-rabbit (polyclonal) | LI-COR | Cat#: 926–32213; RRID:AB_621848 | (1:10,000) |
Antibody | IRDye 800CW conjugated goat anti-mouse (polyclonal) | LI-COR | Cat#: 926–32210; RRID:AB_621842 | (1:10,000) |
Antibody | Anti-TGN46 (sheep polyclonal) | Bio-Rad | Cat#: AHP500G; RRID:AB_323104 |
(1:200) |
Antibody | Anti-paxillin (mouse monoclonal) | BD Biosciences | Cat#: 610051; RRID:AB_397463 | (1:300) |
Antibody | Anti-zyxin (rabbit polyclonal) | Abcam | Cat#: ab71842; RRID:AB_2221280 | (1:100) |
Antibody | Alexa Fluor 647 conjugated anti-sheep (donkey polyclonal) | ThermoFisher | Cat#: A-21448; RRID:AB_2535865 | (1:1000) |
Antibody | Alexa Fluor 647 conjugated anti-mouse (goat polyclonal) | ThermoFisher | Cat#: A-21236; RRID:AB_2535805 | (1:1000) |
Antibody | Alexa Fluor 647 conjugated anti-rabbit (goat polyclonal) |
ThermoFisher | Cat#: A-21245; RRID:AB_2535813 | (1:200) |
Recombinant DNA reagent | His-pUL51 | (Albecka et al., 2017) | ||
Recombinant DNA reagent | His-pUL51 C9S | This paper | Generated by site-directed mutagenesis of His-UL51(FL) to substitute Cys9 with serine |
|
Recombinant DNA reagent | His-pUL51(1-170) | This paper | Residue Cys9 was substituted with serine | |
Recombinant DNA reagent | UL7-GST:pUL51 | This paper | pUL51 residue Cys9 was substituted with serine; Codon optimised pUL7 (GeneArt) | |
Recombinant DNA reagent | UL7-GST:UL51(8-142) | This paper | pUL51 residue Cys9 was substituted with serine; Codon optimised pUL7 (GeneArt) | |
Recombinant DNA reagent | GST-UL7:UL51(8-142) | This paper | pUL51 residue Cys9 was substituted with serine; Codon optimised pUL7 (GeneArt) | |
Recombinant DNA reagent | UL7-GST:UL51(41-142) | This paper | Codon optimised pUL7 (GeneArt) | |
Recombinant DNA reagent | GFP-pUL7 | (Albecka et al., 2017) | ||
Recombinant DNA reagent | pUL51-mCherry | (Albecka et al., 2017) | ||
Recombinant DNA reagent | GFP-pORF53 | This paper | Codon optimized (GeneArt) | |
Recombinant DNA reagent | pORF7-mCherry | This paper | Codon optimized (GeneArt) | |
Recombinant DNA reagent | GFP-pUL103 | This paper | ||
Recombinant DNA reagent | pUL71-mCherry | This paper | ||
Recombinant DNA reagent | GFP-pORF42 | This paper | ||
Recombinant DNA reagent | pORF55-mCherry | This paper | ||
Sequence-based reagent | UL51_C9S_F | This paper | Site-directed mutagenesis primer | CTCGGGGCTATAAGTGGCTGGGGAG |
Sequence-based reagent | UL51_C9S_R | This paper | Site-directed mutagenesis primer | CTCCCCAGCCACTTATAGCCCCGAG |
Software, algorithm | NetSurfP | Technical University of Denmark | http://www.cbs.dtu.dk/services/NetSurfP/ | Version 1.1 |
Software, algorithm | MoreRONN | Dr Varun Ramraj and Dr Robert Esnouf, University of Oxford |
Version 4.6 | |
Software, algorithm | Astra | Wyatt Technology | RRID:SCR_016255 | Version 6 |
Software, algorithm | CSS-Palm | The Cuckoo Workgroup | http://csspalm.biocuckoo.org/online.php | Version 4.0 |
Software, algorithm | I-TASSER | Zhang lab | RRID:SCR_014627 | |
Software, algorithm | PDBeFOLD | EBI | https://www.ebi.ac.uk/msd-srv/ssm/ | |
Software, algorithm | DALI | Holm group, University of Helsinki | RRID:SCR_013433 | |
Software, algorithm | CATHEDRAL | CATH | http://www.cathdb.info/search/by_structure | |
Software, algorithm | Clustal Omega | EBI | RRID:SCR_001591 | |
Software, algorithm | HMMER | HMMER | RRID:SCR_005305 | |
Software, algorithm | ConSurf | ConSurf | RRID:SCR_002320 | |
Software, algorithm | CCP4i2 package | CCP4i2 | RRID:SCR_007255 | Version 7.0 |
Software, algorithm | BUSTER | BUSTER | RRID:SCR_015653 | Version 2.10.3 |
Software, algorithm | PyMOL | PyMOL | RRID:SCR_000305 | Open source version |
Software, algorithm | GraphPad Prism | GraphPad | RRID:SCR_002798 | Version 7 |
Software, algorithm | Inkscape | Inkscape | RRID:SCR_014479 | Version 0.92.3 |
Software, algorithm | ATSAS package | EMBL Hamburg | RRID:SCR_015648 | Version 2.8.4 |
Software, algorithm | Proteome Discoverer | ThermoFisher | RRID:SCR_014477 | Version 2.2.0.388 |
Software, algorithm | CDSSTR | CDSSTR | http://dichroweb.cryst.bbk.ac.uk/ | As implemented by DichroWeb |