| Antibodies |
| rabbit anti Scribble (H-300) |
Santa Cruz |
Cat# sc-28737; RRID:AB_2184807 |
| rabbit anti nNOS (R-20) |
Santa Cruz |
Cat# sc-648; RRID:AB_630935 |
| mouse anti-HA |
Santa Cruz |
Cat# sc-7392; RRID:AB_627809 |
| rabbit anti β-actin |
Cell Signaling Technology |
Cat# 4967; RRID:AB_330288 |
| rabbit anti sGC-β1 |
Cayman chemical |
Cat# 160897; RRID:AB_10080042 |
| rabbit anti KifC2 [N3C2] |
GeneTex |
Cat# GTX124082; RRID:AB_11167943 |
| rabbit anti KifC2 |
Thermo Fisher Scientific |
Cat# PA5-56098, RRID:AB_2643118 |
| mouse anti-FLAG®M2 |
Sigma-Aldrich |
Cat# F1804; RRID:AB_262044 |
| rabbit anti Tuj1 |
Covance |
Cat# PRB-435P-100; RRID:AB_291637 |
| chicken anti MAP2 |
Novus Biologicals |
Cat# NB300-213; RRID:AB_2138178 |
| mouse anti-GFP |
Roche |
Cat# 11814460001; RRID:AB_390913 |
| Alexa Fluor® 488 AffiniPure Goat Anti-Mouse IgG |
Jackson ImmunoResearch |
RRID: AB_2338840 |
| Alexa Fluor® 594 AffiniPure Goat Anti-Mouse IgG |
Jackson ImmunoResearch |
RRID: AB_2338871 |
| Alexa Fluor® 594 AffiniPure Goat Anti-Rabbit IgG |
Jackson ImmunoResearch |
RRID: AB_2338059 |
| Alexa Fluor® 488 AffiniPure Goat Anti-Rabbit IgG |
Jackson ImmunoResearch |
RRID: AB_2338046 |
| Alexa Fluor® 647 AffiniPure Goat Anti-Rabbit IgG |
Jackson ImmunoResearch |
RRID: AB_2338072 |
| Alexa Fluor® 594 AffiniPure Goat Anti-Chicken |
Jackson ImmunoResearch |
RRID: AB_2337391 |
| rabbit anti STRAD (Y-25) |
Santa Cruz |
Cat# sc-130882; RRID:AB_2197574 |
| Bacterial and Virus Strains |
| DH5α competent cells |
Life Technologies |
Cat#18265017 |
| Chemicals, Peptides, and Recombinant Proteins |
| Fluorescently conjugated Bovine Serum Albumin (BSA) |
Life Technologies |
Cat#A13100 |
| Guanosine- 3′, 5′- cyclic monophosphate, acetoxymethyl ester (cGMP-AM) |
BIOLOG |
Cat#G002 |
| Hoescht 33342 (bis-benzimide 33342) |
Sigma-Aldrich |
Cat#B2261 |
| Triton X-100 |
Millipore Sigma |
Cat#TX1568-1 |
| Fast Green |
Sigma-Aldrich |
Cat#F7252 |
| Fluoromount-G |
SouthernBiotech |
Cat#0100-01 |
| Phosphate buffered saline |
Sigma-Aldrich |
Cat#P4417 |
| Normal Goat Serum |
Jackson ImmunoResearch |
RRID: AB_2336990 |
| Amersham Hyperfilm ECL |
GE Healthcare |
Cat#28906839 |
| Amersham ECL Western Blotting Detection Reagents |
GE Healthcare |
Cat#RPN2209 |
| Protein G agarose |
Roche |
Cat#11719416001 |
| CHAPS hydrate |
Millipore Sigma |
Cat#9426 |
| Nitrocellulose Membranes 0.45um |
BIO RAD |
Cat#1620115 |
| Tween 20 |
BIO RAD |
Cat#170-6531 |
| Paraformaldehyde |
Milipore Sigma |
Cat#441244 |
| 0.25% Trypsin-EDTA |
GIBCO |
Cat#25200056 |
| GlutaMAX |
GIBCO |
Cat#35050061 |
| Neurobasal Medium minus Phenol Red |
GIBCO |
Cat#12348017 |
| Neurobasal Medium |
GIBCO |
Cat#21103049 |
| Hibernate E minus CaCl2 |
BrainBits |
Cat#HECA |
| Hibernate E |
BrainBits |
Cat#HE |
| Papain |
Worthington Biochemical Corporation |
Cat#LK003178
|
| Poly-L-Lysine Hydrochloride |
Millipore Sigma |
Cat#P9404 |
| B-27 Supplement |
Life Technologies |
Cat#17504044 |
| Critical Commercial Assays |
| EndoFree Plasmid Maxi Kit |
QIAGEN |
Cat#12362 |
| Experimental Models: Cell Lines |
| HEK293 |
ATCC |
Cat# PTA-4488 |
| Experimental Models: Organisms/Strains |
|
|
| CD® (Sprague Dawley) rats |
Charles River |
RRID:RGD_734476 |
| B6.129S2-Emx1tm1(cre)Krj/J mice |
Jackson Laboratory |
RRID:IMSR_JAX:005628 |
| Conditional Scribbleflox/flox mice |
Gift from Dr. T.B. Huber, Department of Medicine, University Medical Center Hamburg-Eppendorf, Hamburg, |
N/A |
| Oligonucleotides |
| shScrib#1 |
This study |
GATCCCAGAGATCTTGAAGTGCTTCTTTTGATATCCGAAGAAGCACTTCAAGATCTCTTTTTTTCCAAA |
| shScrib#2 |
This study |
GATCCCAGGGAGAGATTTAAGCAGGTTTTGATATCCGAACCTGCTTAAATCTCTCCCTTTTTTTCCAAA |
| shScrib#3 |
This study |
GATCCCGCCCTGTAGTCAAACTTCTTTTTGATATCCGAAAGAAGTTTGACTACAGGGCTTTTTTCCAAA |
| shKifC2#1 |
This study |
GATCCCGAAGTCTACTCAGCTCTTCTTTTGATATCCGAAGAAGAGCTGAGTAGACTTCTTTTTTCCAAA |
| shKifC2#2 |
This study |
GATCCCGCAAGAGCTGACTTGTTACTGTTTGATATCCGACAGTAACAAGTCAGCTCTTGTTTTTTCCAAA |
| shKifC2#3 |
This study |
GATCCCGTGTCAGTACTGAGAGAAGAATTGATATCCGTTCTTCTCTCAGTACTGACACTTTTTTCCAAA |
| Recombinant DNA |
| PRNT U6.1 vector |
GeneScript |
N/A |
| shScrib#1 |
This study |
N/A |
| shScrib#2 |
This study |
N/A |
| shScrib#3 |
This study |
N/A |
| pCAGJC-HA-rat Scribble, Scribble-cDNA |
This study |
N/A |
| DLRR |
This study |
N/A |
| PDZ/C |
This study |
N/A |
| C-term |
This study |
N/A |
| LRR |
This study |
N/A |
| IMR |
This study |
N/A |
| PDZs |
This study |
N/A |
| DIMR |
This study |
N/A |
| DPDZs |
This study |
N/A |
| DC-term |
This study |
N/A |
| pCAGJC-FLAG-nNOS |
This study |
N/A |
| pcDNA3.1 nNOS-GFP |
Gift from Dr. Bonnie Firestein, Rutgers, the State University of New Jersey, Piscataway, NJ |
N/A |
| pCAGJC-FLAG-rat sGC-β1 |
This study |
N/A |
| pCAGJC-dTomato |
Shelly et al., 2007 |
N/A |
| pCAGJC-EGFP |
Shelly et al., 2007 |
N/A |
| shKifC2#1 |
This study |
N/A |
| shKifC2#2 |
This study |
N/A |
| shKifC2#3 |
This study |
N/A |
| Software and Algorithms |
| ImageJ Fiji software |
|
RRID:SCR_002285 |
| Prism v8.1.2 |
GraphPad |
RRID:SCR_002798 |
| IMRS 7.3.1 |
Bitplane |
RRID:SCR_007370 |
