Table 2.
Primer | Sequence(5′→3′)* | Description |
---|---|---|
pNdeISIP_F | GGAGTATGATTCATATGTTTAGTCGTCCAGGTTTGC | Forward primer for amplification of AgE6 from pUC57-AgE6 |
pAgESATCyt-R | GGAAACAGCTATGACCATGATTAC | Reverse primer for amplification of AgE6 from pUC57-AgE6 |
Ag85Fus3014F | CAACGAGTTCAACTGTCGACTTTAGTCGTCCAGGTT | Forward primer for amplification of AgE6 from Lp_1261AgE6-DC. Contains SalI restriction site. |
Ag85DC-R | GCCAAGCTTCGAATTCTTATGGCCGTTGTGGCGT | Reverse primer for amplification of AgE6 from Lp_1261AgE6-DC. Contains an EcoRI restriction site. |
*Restriction sites in italics.