Skip to main content
. 2020 Jun 15;10:9640. doi: 10.1038/s41598-020-66531-7

Table 2.

Primers used in this study.

Primer Sequence(5′→3′)* Description
pNdeISIP_F GGAGTATGATTCATATGTTTAGTCGTCCAGGTTTGC Forward primer for amplification of AgE6 from pUC57-AgE6
pAgESATCyt-R GGAAACAGCTATGACCATGATTAC Reverse primer for amplification of AgE6 from pUC57-AgE6
Ag85Fus3014F CAACGAGTTCAACTGTCGACTTTAGTCGTCCAGGTT Forward primer for amplification of AgE6 from Lp_1261AgE6-DC. Contains SalI restriction site.
Ag85DC-R GCCAAGCTTCGAATTCTTATGGCCGTTGTGGCGT Reverse primer for amplification of AgE6 from Lp_1261AgE6-DC. Contains an EcoRI restriction site.

*Restriction sites in italics.