Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for amplification of the two SNPs of the ET-1 gene.
| Name of the primer | Nucleotide sequences | |
|---|---|---|
| −138insA/delA (rs1800997) | Forward | 5′>TTCTCTCCTGGCAGG<3′ |
| Reverse | 5′> ATCTCAAAGCGATCCTTC<3′ | |
| G198T (rs5370) | Forward | 5′> TCTTTTGCCAAAGGGTGATT <3′ |
| Reverse | 5′> CAGGGTGGAGAGTGCAGAG <3′ |
+138insA/delA (rs1800997): 138 I/D; G198T (rs5370): Lys198Asn.
