Key resources table.
Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
---|---|---|---|---|
Gene (Homo sapiens) | PCK1 | HGNC: 8724 | ||
Gene (M. musculus) | Pck1 | MGI:97501 | ||
Gene (Homo sapiens) | DHODH | HGNC: 2867 | ||
Cell line (Homo sapiens) | SW480 | ATCC | CCL-228 | RRID:CVCL_0546 |
Cell line (Homo sapiens) | LS174T | ATCC | CL-188 | RRID:CVCL_1384 |
Cell line (Homo sapiens) | Lvm3b | Tavazoie Lab | Derived from in vivo selection of LS174T cells | |
Cell line (Homo sapiens) | 293LTV | Cell Biolabs | LTV100 | RRID:CVCL_JZ09 |
Cell line (M. musculus) | CT26 | ATCC | CRL-2638 | RRID:CVCL_7256 |
Transfected construct (Homo sapiens) | shRNA to PCK1 | Sigma | PCK1 sh3 (TRCN0000196706), PCK1 sh4 (TRCN0000199286), PCK1 sh5 (TRCN0000199573), shControl (SHC002), | Lentiviral construct to transfect and express the shRNA. |
Transfected construct (Homo sapiens) | shRNA to DHODH | Sigma | DHODH sh2 (TRCN0000221421), and DHODH sh3 (TRCN0000221422) | Lentiviral construct to transfect and express the shRNA. |
Biological sample (Homo sapiens) | Colorectal cancer PDXs | MSKCC | CLR1, 3, 4, 7, 20,27–1, 28, 32–1, 10, 11, 19, 24, 25, 26, and 30 | MSKCC Institutional Review Board/Privacy Board (protocol 10-018A) |
Biological sample (Homo sapiens) | In vivo selected colorectal cancer PDXs | Tavazoie Lab | CLR4LVM, CLR27LVM, CLR28LVM, and CLR32LVM | The Rockefeller University Institutional Review Board (protocol STA-0681) |
Antibody | APC-anti human CD326(mouse monoclonal) | BioLegend | 324207 | FACS: 5 ul/1 million cells RRID:AB_756081 |
Antibody | FITC-anti mouse H-2Kd(mouse monoclonal) | BioLegend | 116606 | FACS: 1 ul/1 million cells RRID:AB_313741 |
Recombinant DNA reagent | pLKO.1-puro | Addgene | 8453 | RRID:Addgene_8453 |
Recombinant DNA reagent | pBABE-puro | Addgene | 1764 | RRID:Addgene_1764 |
Recombinant DNA reagent | plx304-blast | Addgene | 25890 | RRID:Addgene_25890 |
Sequence-based reagent | PCK1-F (Homo sapiens) | This paper | qPCR primer | AAGGTGTTCCCATTGAAGG |
Sequence-based reagent | PCK1-R (Homo sapiens) | This paper | qPCR primer | GAAGTTGTAGCCAAAGAAGG |
Sequence-based reagent | PCK1-F (M. musculus) | This paper | qPCR primer | CTGCATAACGGTCTGGACTTC |
Sequence-based reagent | PCK1-R (M. musculus) | This paper | qPCR primer | CAGCAACTGCCCGTACTCC |
Commercial assay or kit | MACS kit | Miltenyi | 130-104-694 | |
Chemical compound, drug | Leflunomide | Tocris | 2228 | |
Software, algorithm | PRISM | Graphpad | Version 8 | |
Software, algorithm | Rstudio | Rstudio, Inc. | Version 1.2.5001 | |
Other | U-13C-glutamine | Cambridge Isotope Laboratories |
CLM-1822-H |