KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal anti-KAP1	Abcam	Cat# Ab22553; RRID: AB_447151; lot #GR229743-12
hFAB Rhodamine anti-Actin	Bio-Rad	Cat# 12004166
Rabbit polyclonal anti-RPB3 (RNA Pol II)	MilliporeSigma	Cat# ABE999; lot #Q2550840
Rat monoclonal anti-RNA Pol II CTD phospho Ser5	Active Motif	Cat# 61085; lot #20017002; RRID: AB_2687451
Rat monoclonal anti-RNA Pol II CTD phospho Ser2	MillliporeSigma	Cat# 04-1571; lot # 2724427; RRID: AB_10627998
Rabbit polyclonal anti-CDK9 (C-20)	Santa Cruz Biotechnology	Cat# Sc-484; lot # B2605; RRID: AB_2275986
Rabbit monoclonal anti-CDK9	Abcam	Cat# ab236045; lot # GR3235366-1
Mouse monoclonal anti-RNA Pol II (4H8)	Active Motif	Cat# 39097; RRID: AB_2732926
Rabbit polyclonal anti-SMAD2	Thermo Fisher Scientific	Cat# PA5-29237; lot #UD2753805A RRID: AB_2546713
Mouse monoclonal anti-FLAG M2	MilliporeSigma	Cat# F3165; lot #SLBT6752 RRID: AB_259529
Rabbit monoclonal anti-pSMAD2	Cell Signaling Technology	Cat# 8828; lot #7; RRID: AB_2631089
Rabbit polyclonal anti-GST	MilliporeSigma	Cat# G7781; lot #108M4775V; RRID: AB_259965
Rabbit polyclonal anti-H3	Abcam	Cat# ab1791; lot #940378; RRID: AB_302613
Rabbit polyclonal anti-H4	Abcam	Cat# ab7311; lot #GR325224-4; RRID: AB_305837
Rabbit polyclonal anti-H2A	Active Motif	Cat# 39209; lot #09617014; RRID: AB_2793184
Rabbit polyclonal anti-H2B	Active Motif	Cat# 39210; lot #34515005; RRID: AB_2793185
Mouse monoclonal anti-CDK9 (D7)	Santa Cruz Biotechnology	Cat# sc-13130; lot #50917; RRID: AB_627245
Mouse monoclonal anti-NELFE	Santa Cruz Biotechnology	Cat# sc-377052; lot #L0117
Rabbit polyclonal anti-H4K16ac	Active Motif	Cat #39068
Monoclonal anti-Strep-HRP	MilliporeSigma	Cat# 71591; lot #3150780; RRID: AB_11214448
Anti-mouse-HRP	Cell Signaling Technology	Cat# 7076; lot #33; RRID: AB_330924
Anti-rabbit-HRP	Cell Signaling Technology	Cat# 7074; lot #27; RRID: AB_2099233
Anti-mouse-HRP	Rockland	Cat# 18-8817-33 RRID: AB_2610851
Anti-rabbit-HRP	Rockland	Cat# 18-8816-33 RRID: AB_2610848
Anti-mouse-Starbright Blue 700	Bio-Rad	Cat# 12004159
Anti-rabbit-Starbright Blue 700	Bio-Rad	Cat# 12004162
Anti-H2Av	Active Motif	Cat# 61686
Bacterial and Virus Strains
E. coli BL21 DE3	NEB	Cat# C2527I
E. coli DH5α	NEB	Cat# C2987I
E. coli XL-10 Gold	Agilent	Cat# 200522 (as part of the QuickChange II XL site-directed mutagenesis kit)
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
DMEM	HyClone	Cat# SH30022.FS
FBS	MilliporeSigma	Cat# 9268
Penicillin/Streptomycin	MP Biomedicals	Cat# 091670049
Tween-20	Fisher Chemical	Cat# BP337-500
Non-fat Dry Milk	LabScientific	Cat# M0841
0.45 μM Nitrocellulose Membrane	Bio-Rad	Cat# 1620115
BsmB1	NEB	Cat# R0580
Quick Ligase	NEB	Cat# M2200
Polybrene (Hexadimethrine Bromide)	MilliporeSigma	Cat# H9268
4-thio-uridine (4sU)	MilliporeSigma	Cat# T4509
Biotin-HPDP	Thermo Fisher Scientific	Cat# 21341
TRizol	Thermo Fisher Scientific	Cat# 15596026
DNase	NEB	Cat# M0303
Acid:Phenol:Chloroform	Thermo Fisher Scientific	Cat# AM9720
Chloroform	Fisher Scientific	Cat# C606SK-1
Dimethylformamide	Acros Organics	Cat# 279600010
Dynabeads MyOne Streptavidin T1	Thermo Fisher Scientific	Cat# 65601
Polyvinylpyrrolidone	Fisher Scientific	Cat# BP431
ERCC spike-ins	Thermo Fisher Scientific	Cat# 4456740
Methanol-free formaldehyde	Thermo Fisher Scientific	Cat# 28908
Protease Inhibitor Tablets	MilliporeSigma	Cat# 4693159001
Protein G Dynabeads	Thermo Fisher Scientific	Cat# 10003D
Drosophila Spike-in Chromatin	Active Motif	Cat# 53083
Proteinase K	MilliporeSigma	Cat# 3115879001
SYBR Green	Thermo Fisher Scientific	Cat# 4385612
Doxycycline Hydrochloride	Fisher Scientific	Cat# BP2653-1
Flavopiridol	MilliporeSigma	Cat# F3055
Clarity Western ECL Substrate	Bio-Rad	Cat# 1705061
DMSO	Acros Organics	Cat# 61042-0010
Micrococcal Nuclease	NEB	Cat# M0247S
PolyJet	SignaGen	Cat# SL100688
StrepTactin Agarose	IBA Life Sciences	Cat# 2-1201-010
10X Strep Elution Buffer with Desthiobiotin	IBA Life Sciences	Cat# 2-1000-025
Anti-FLAG M2 Affinity Gel	Millipore Sigma	Cat# A2220
3X FLAG Peptide	Millipore Sigma	Cat# F4799
27-gauge needle	BD Biosciences	Cat# 305109
Trypan blue stain	Corning	Cat# 25-900-CI
Super Signal West Femto Luminol Enhancer	Thermo Fisher Scientific	Cat# 185022
Opti-MEM	Thermo Fisher Scientific	Cat# 31985062
RNAi Max	Thermo Fisher Scientific	Cat# 13778030
Trypsin/EDTA	Thermo Fisher Scientific	Cat# R001100
Trypsin Neutralizing Agent	Thermo Fisher Scientific	Cat# R002100
TGFβ-1	PeproTech	Cat# 100-21 Lot #0218209-3 B1918
CutSmart Buffer	NEB	Cat# B7204S
Calf Intestinal alkaline phosphatase	NEB	Cat# M0290
Paraformaldehyde	MilliporeSigma	Cat# P6148
GST Agarose	MilliporeSigma	Cat# G4510
L-Glutathione Reduced	MilliporeSigma	Cat# G4251
Thrombin	MP Biomedicals	Cat# 0219492182
Mononucleosomes, Recombinant Human Biotinylated	EpiCypher	Cat# 16-0006
Histone H4 N-terminal peptide, biotinylated (1–23)	EpiCypher	Cat# 12-0029
Histone H3 N-terminal peptide, biotinylated (1–20)	EpiCypher	Cat# 12-0001
Histone H2A N-terminal peptide, biotinylated (1–17)	EpiCypher	Cat# 12-0012
Histone H2B N-terminal peptide, biotinylated (1–24)	EpiCypher	Cat# 12-0077
Histone H4K5ac peptide, biotinylated (1–23)	EpiCypher	Cat# 12-0030
Histone H4K8ac peptide, biotinylated(1–23)	EpiCypher	Cat# 12-0031
Histone H4K12ac peptide, biotinylated (1–23)	EpiCypher	Cat# 12-0032
Histone H4K16ac peptide, biotinylated (1–23)	EpiCypher	Cat# 12-0033
Histone H4Kac(4) peptide, biotinylated (1–23)	EpiCypher	Cat# 12-0103
Histone H4R3me1 peptide, biotinylated (1–23)	EpiCypher	Cat# 12–0111
Histone H4R3me2(s) peptide, biotinylated (1–23)	EpiCypher	Cat# 12-0059
Histone H4R3me2(a) peptide, biotinylated (1–23)	EpiCypher	Cat# 12-0058
Histone H4 N-terminal peptide, biotinylated (11–27)	EpiCypher	Cat# 12-0035
Histone H4K20me1 peptide, biotinylated (11–27)	EpiCypher	Cat# 12–0036
Histone H4K20me2 peptide, biotinylated (11–27)	EpiCypher	Cat# 12-0037
Histone H4K20me3 peptide, biotinylated (11–27)	EpiCypher	Cat# 12-0038
Histone H3 N-terminal peptide, biotinylated (1–30)	GenScript	Custom
Histone H3K23ac N-terminal peptide, biotinylated (1–30)	GenScript	Custom
Histone H3 N-terminal peptide, biotinylated (1–20)	EpiCypher	Cat# 12-0001
Histone H3K9me3 peptide, biotinylated (1–20)	EpiCypher	Cat# 12-0012
Histone H3K18ac Peptide, biotinylated (1–20)	EpiCypher	Cat# 12-0005
Critical Commercial Assays
Plasmid MiniPrep Kit	Qiagen	Cat# 27104
Zymo RNA Clean and Concentrator Kit	Zymo Research	Cat# R1013
Qubit RNA HS Assay	Thermo Fisher Scientific	Cat# Q32852
Tapestation RNA ScreenTape	Agilent	Cat# 5067-5576
KAPA Stranded RNA-seq kit with RiboErase	KAPA Biosystems	Cat# KK8483
Tapestation DNA ScreenTape	Agilent	5067-5582
Qubit dsDNA HS Assay	Thermo Fisher Scientific	Cat# Q32851
KAPA Hyper Prep Kit	KAPA Biosystems	KK8502
Zymo Quick-RNA MiniPrep Kit	Zymo Research	R1055
Zymo Quick DNA Clean & Concentrator Kit	Zymo Research	D5201
Quick Ligase Kit	NEB	Cat# M2200L
M-MuLV Reverse Transcriptase and buffer	NEB	Cat# M02553L
Pierce BCA Protein Assay Kit	Thermo Fisher Scientific	Cat# 23225
Quick Change II Site-Directed Mutagenesis Kit	Agilent	Cat# 3200522
Deposited Data
Raw and analyzed NGS Data	This paper	GEO: GSE132705
HEXIM and LARP7 ChIP-seq datasets	McNamara et al., 2016	GEO: GSE72622
Source data for western blots	This paper	Mendeley: http://dx.doi.org/10.17632/fc56g3m8ff.1
KAP1-PHD-BD (apo) structure	Zeng et al., 2008	PDB: 2RO1
Chemical shift assignments for KAP1-PHD-BD	Zheng et al., 2008	BMRB ID: 11036
Experimental Models: Cell Lines
HEK293T	ATCC	CRL-11268
HCT116	ATCC	CCL-247
MCF7	ATCC	HTB-22
HCT116 Ctrl	Laboratory of Iván D’Orso	Created in this study
HCT116 KAP1 KO1	Laboratory of Iván D’Orso	Created in this study
HCT116 KAP1 KO2	Laboratory of Iván D’Orso	Created in this study
293 T-REx KAP1:S	Laboratory of Iván D’Orso	Created in this study
HCT116 shNT	Laboratory of Iván D’Orso	(McNamara, et al., 2016)
HCT116 shKAP1	Laboratory of Iván D’Orso	(McNamara, et al., 2016)
HCEC 1CT	Laboratory of Jerry Shay	(Roig et al., 2010)
Experimental Models: Organisms/Strains
Oligonucleotides
See Table S1 for all DNA oligonucleotide sequences used for RT-qPCR analysis and cloning
Illumina Adapters and Indexed Primers	NEB	Cat# E7335L
siKAP1_1 targeting KAP1’s CDS	Qiagen	Cat# SI03171903
siKAP1_2 targeting KAP1’s 3’UTR	Qiagen	Cat# SI05121214
siRNA targeting SMAD2: GAACAAACCAGGUCUCUUG	Dharmacon	Cat# D-003561-01
siRNA targeting SMAD2: GCAGAACUAUCUCCUACUA	Dharmacon	Cat# D-003561-02
siRNA targeting SMAD2: GAAGAGGAGUGCGCUUAUA	Dharmacon	Cat# D-003561-03
siRNA targeting SMAD2: GGUGUUCGAUAGCAUAUUA	Dharmacon	Cat# D-003561-04
shRNA non-target: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT	MilliporeSigma	Cat# SHC002
shRNA targeting CDK9: CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCTAACGGACCAAACTGTGCTTTTT	MilliporeSigma	Cat# TRCN0000000494
shRNA targeting KAP1: CCGGCCTGGCTCTGTTCTCTGTCCTCTCGAGAGGACAGAGAACAGAGCCAGGTTTTT	MilliporeSigma	Cat# TRCN0000017998
Recombinant DNA
Plasmid: LentiCRISPRv2	Addgene	Cat# 52961
Plasmid: pSPAX	Addgene	Cat# 12260
Plasmid: pMD2.G	Addgene	Cat# 12259
Plasmid: LentiCRISPRv2-KAP1-gRNA1	This Paper	N.A.
Plasmid: LentiCRISPRv2-KAP1-gRNA2	This Paper	N.A.
Plasmid: pLKO.1/Doxycycline Inducible	Addgene	Cat# 21915
Plasmid: pLKO.1/Doxycycline Inducible-shNT	Addgene	Cat# 47541
Plasmid: pLKO.1/Doxycycline Inducible-shCDK9	This Paper	N.A.
Plasmid: pcDNA4/TO	Thermo Fisher Scientific	V102020
Plasmid: pcDNA4/TO/Strep/FLAG-GFP	McNamara et al., 2016	N.A.
Plasmid: pcDNA4/TO/Strep-KAP1	McNamara et al., 2016	N.A.
Plasmid: pcDNA4/TO/FLAG-SMAD2	This Paper	N.A.
Plasmid: pGEX2T-GST	GE Life Sciences	Cat# 28954653
Plasmid: pGEX2T/-GST-KAP1-PHD-BD	This Paper	N.A.
Plasmid: pGEX2T-GST-KAP1-PHD	This Paper	N.A.
Plasmid: pGEX2T-GST-KAP1-PHD-BD-E662/663A	This Paper	N.A.
Plasmid: pGEX2T-GST-KAP1-PHD-BD-L637A	This Paper	N.A.
Plasmid: pGEX2T-GST-TRIM24-PHD-BD	This Paper	N.A.
Plasmid: pGEX2T-GST-TRIM33-PHD-BD	This Paper	N.A.
Plasmid: pcDNA4/TO/FLAG-KAP1	McNamara et al., 2016	N.A.
Plasmid: pcDNA4/TO/FLAG-KAP1-ΔPHD-BD	This Paper	N.A.
Plasmid: pcDNA4/TO/FLAG-KAP1-ΔBD	This Paper	N.A.
Plasmid: pcDNA4/TO/FLAG-KAP1-ΔPHD	This Paper	N.A.
Plasmid: pcDNA4/TO/FLAG-KAP1-ΔCC	This Paper	N.A.
Plasmid: pcDNA4/TO/FLAG-KAP1-ΔRB	This Paper	N.A.
Plasmid: pcDNA4/TO/FLAG-KAP1-ΔRBCC	This Paper	N.A.
Software and Algorithms
STAR/2.6.1b	Dobin et al., 2013	http://github.com/alexdobin/STAR
Subread/1.6.1	N.A.	http://bioinf.wehi.edu.au/subread-package/
RUVSeq/1.15	Risso et al., 2014	https://bioconductor.org/packages/release/bioc/html/RUVSeq.html
UCSC_userApps/v317	N.A.	https://genome-source.gi.ucsc.edu/gitlist/kent.git/blob/master/src/userApps/README
Integrated Genome Viewer (IGV)	Robinson et al., 2011	https://software.broadinstitute.org/software/igv/download
deepTools/2.5.0	Ramirez et al., 2016	https://deeptools.readthedocs.io/en/develop/content/installation.html
Java Treeview	Saldanha, 2004	https://sourceforge.net/projects/jtreeview/files/
Trimgalore v.0.4.1	N.A.	https://github.com/FelixKrueger/TrimGalore
Fastqc/0.11.2	N.A.	https://raw.githubusercontent.com/s-andrews/FastQC/master/INSTALL.txt
Bowtie2/2.1.0	Langmead and Salzberg, 2012	http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
Picard/1.127		https://github.com/broadinstitute/picard
Macs/2.1.0-20151222	Zhang et al., 2008	https://github.com/taoliu/MACS/blob/master/INSTALL.md
SAMtools v1.6	Li et al., 2009	https://github.com/samtools/samtools/blob/develop/INSTALL
R/v3.4.1	N.A.	http://www.r-project.org
bamR	N.A.	https://github.com/rchereji/bamR
GraphPad Prism v8.1.0	N.A.	https://www.graphpad.com/scientific-software/prism/?gclid=Cj0KCQjwoInnBRDDARIsANBVyAST15UIY85-IY-6-_aDTwJl5hMTpw4Q4Nf16CZUjB1q_ld2oCjC97UaAjfCEALw_wcB
GROMACS 5	Abraham, M.J., et al. 2015	http://manual.gromacs.org/documentation/
AMBER99SB-ILDN	Lindorff-Larsen, et al., 2010	http://www.gromacs.org/Documentation/Terminology/Force_Fields/AMBER
UCSF Chimera	Pettersen et al., 2004	https://www.cgl.ucsf.edu/chimera/
Other
Detailed scripts and commands used for NGS data analysis in this study	N.A.	https://git.biohpc.swmed.edu/ivandorsolab/Curtis_Dissertation