Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
PCR Primers Used in This Study
| Gene | Description | Sequence (5′→3′) | Reference |
|---|---|---|---|
| intF | Screening primer for class 1 integrons | CCAAGCTCTCGGGTAACATC | 5 |
| P2R | Screening primer for class 1 integrons | GCCCAGCTTCTGTATGGAAC | 5 |
| 5CS | Screening primer for the variable region of class 1 integrons | GGCATCCAAGCAGCAAG | 5 |
| 3CS | Screening primer for the variable region of class 1 integrons | AAGCAGACTTGACCTGA | 5 |
