Skip to main content
. Author manuscript; available in PMC: 2021 May 13.
Published in final edited form as: Cell Host Microbe. 2020 May 13;27(5):710–724.e7. doi: 10.1016/j.chom.2020.04.007

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
DENV-66 (hybridoma-produced Ig) This manuscript N/A
DENV-115 (hybridoma-produced Ig) This manuscript N/A
DENV-144 (hybridoma-produced Ig) This manuscript N/A
DENV-236 (hybridoma-produced Ig) This manuscript N/A
DENV-297 (hybridoma-produced Ig) This manuscript N/A
DENV-286 (hybridoma-produced Ig) This manuscript N/A
DENV-290 (hybridoma-produced Ig) This manuscript N/A
DENV-298 (hybridoma-produced Ig) This manuscript N/A
DENV-254 (hybridoma-produced Ig) This manuscript N/A
DENV-404 (hybridoma-produced Ig) This manuscript N/A
DENV-406 (hybridoma-produced Ig) This manuscript N/A
DENV-415 (hybridoma-produced Ig) This manuscript N/A
DENV-419 (hybridoma-produced Ig) This manuscript N/A
DENV-437 (hybridoma-produced Ig) This manuscript N/A
DENV-443 (hybridoma-produced Ig) This manuscript N/A
DENV-5J7 (plasmid-produced Ig) Beltramello, Williams et al. 2010 N/A
DENV-14c10 (plasmid-produced Ig) Teoh, Kukkaro et al. 2012 N/A
DENV-1F4 (hybridoma-produced Ig) Fibiansah, Tan et al. 2014 N/A
EDE1-C8 (plasmid-produced Ig) Rouivinski, Guardado-Calvo et al. 2015 N/A
EDE1-C10 (plasmid-produced Ig) Rouivinski, Guardado-Calvo et al. 2015 N/A
DENV-2D22 (hybridoma-produced Ig) Smith et al., 2015 N/A
Goat anti-Human IgG (Fc)-AP Meridian Life Science, Inc. Cat# W99008A
DENV-4G2(hybridoma-produced Ig) ATCC® HB-112 D1–4G2–4-15
DENV-2H2(hybridoma-produced Ig) ATCC® HB-114 D3–2H2–9-21
Bacterial and Virus Strains
DENV1 Thailand/16007/1964 Buddhari et al., 2014, PMC4199527 N/A
DENV1 Nauru/West Pac/1974 Puri et al., 2000, DOI: 10.1023/A:1008160123754 N/A
DENV1 N1265–04 Andrade et al., 2017 N/A
DENV1ic West Pac 74 Gallichotte et al., 2017 N/A
DENV2 Thailand/16681/1964 Buddhari et al., 2014, PMC4199527 N/A
DENV2 Thailand/S16803/1974 Kelly et al., 2011, DOI 10.1007/s11262–011-0602-z N/A
DENV2 N172–06 Andrade et al., 2017 N/A
DENV2ic 16803 Gallichotte et al., 2015 N/A
DENV3 Philippines/16562/964 Buddhari et al., 2014, PMC4199527 N/A
DENV3 Thailand/CH53489/1973 Wahala et al., 2010 N/A
DENV3 N2845–09 Hadjilaou et al., 2015, doi:10.4049/jimmunol.1500918 N/A
DENV3ic SriLanka 89 GIII Messer et al., 2012 N/A
DENV3 UNC3009, G-III Messer et al., 2016 N/A
DENV4 Indonesia/1036/1976 Buddhari et al., 2014, PMC4199527 N/A
DENV4 Columbia/TVP-376/1982 Sukupolve-Petty et al., 2013 N/A
DENV4 N703–99 Hadjilaou et al., 2015, doi:10.4049/jimmunol.1500918 N/A
DENV4ic SriLanka 92 Widman, Young et al. 2017 N/A
DENV3/4 M16 Widman, Young et al. 2017 N/A
DENV3/1 EDI A Messer, Yount et al. 2016 N/A
DENV3/1 EDI B This manuscript N/A
DENV3/1 EDI/III C This manuscript N/A
DENV3/1 EDI/III D This manuscript N/A
DENV1/3 EDI A This manuscript N/A
DENV1/3 EDI B This manuscript N/A
DENV3 Indonesia 1982, genotype I Messer, Yount et al. 2012 N/A
DENV3 Thailand 1995, genotype II Messer, Yount et al. 2012 N/A
DENV3 Cuba 2002, genotype III Messer, Yount et al. 2012 N/A
DENV3 Puerto Rico 1977, genotype IV Messer, Yount et al. 2012 N/A
DENV3 GIV with GIII EDI This manuscript N/A
DENV3 GIV with GIII EDII This manuscript N/A
DENV3 GIV with GIII EDIII This manuscript N/A
DENV3 GIII with GIV EDI This manuscript N/A
DENV3 GIII with GIV EDII This manuscript N/A
DENV3 GIII with GIV EDII This manuscript N/A
Biological Samples
PBMCs from DENV infection survivors This manuscript Nicaraguan Pediatric Dengue Cohort Study Donor ID #3243, #985, and #1791
Chemicals, Peptides, and Recombinant Proteins
1-Step Ultra TMB-ELISA Thermo Fisher Scientific Cat# 34029
Dulbecco’s Phosphate-Buffered Saline, 1X with calcium and magnesium Corning Life Sciences Cat# 21–030-CM
50x HAT media supplement Sigma-Aldrich Cat# H0137
Ouabain Sigma-Aldrich Cat# O3125
HyClone insect cell culture medium GE Healthcare Life Sciences Cat# SH30280.03
Fetal Bovine Serum, ultra-low IgG Thermo Fisher Scientific Cat# 16250078
100x Penicillin Streptomycin Glutamine Thermo Fisher Scientific Cat# 10378016
ClonaCell-HY Medium E Stem Cell Technologies Cat# 03805
ClonaCell-HY Medium A Stem Cell Technologies Cat# 03801
DMEM, high glucose, GlutaMAX™ Supplement Thermo Fisher Scientific Cat# 10566–024
Dulbecco’s modified Eagle’s/Ham’s F-12 50/50 Mix Gibco 10–092-CV
Opti-MEM I Gibco 31985–070
GIBCO Hybridoma-SFM Thermo Fisher Scientific Cat# 12045076
Recombinant DENV E protein Kudlacek et al., 2018 N/A
Recombinant DENV E protein stabilized dimers Kudlacek et al., 2018 N/A
CpG10103 (TCGTCGTTTTTCGGTCGTTTT) Synthesized by Invitrogen N/A
TrueBlue substrate KPL 0510–0050
Cyclosporin A Sigma-Aldrich Cat# C1832
Chk2 inhibitor Sigma-Aldrich Cat# C3742
Non-fat dry milk Bio Rad Cat# 1706404
Goat serum Thermo Fisher Scientific Cat# 16210072
Critical Commercial Assays
Deposited Data
Experimental Models: Cell Lines
Mouse-human HMAA 2.5 myeloma cell line Dr. Marshall Posner N/A
DENV-66 hybridoma clone This manuscript N/A
DENV-115 hybridoma clone This manuscript N/A
DENV-144 hybridoma clone This manuscript N/A
DENV-236 hybridoma clone This manuscript N/A
DENV-297 hybridoma clone This manuscript N/A
DENV-298 hybridoma clone This manuscript N/A
DENV-286 hybridoma clone This manuscript N/A
DENV-290 hybridoma clone This manuscript N/A
DENV-254 hybridoma clone This manuscript N/A
DENV-404 hybridoma clone This manuscript N/A
DENV-406 hybridoma clone This manuscript N/A
DENV-415 hybridoma clone This manuscript N/A
DENV-419 hybridoma clone This manuscript N/A
DENV-437 hybridoma clone This manuscript N/A
DENV-443 hybridoma clone This manuscript N/A
C6/36 cells ATCC CRL-1660
U937-DC-SIGN cells
Vero-81 cells ATCC CCL-81
Experimental Models: Organisms/Strains
Mouse: AG129 strain M. Aguet (Swiss Institute for Experimental Cancer Research, Epalinges, Switzerland) N/A
Recombinant DNA
Primer: DENV1–4, D1: 5'-TCA ATA TGC TGA AAC GCGCGA GAA ACC G Harris et al., 1998, PMID: 9705406 N/A
Primer: DENV1–4, D2: 5’-TTGCACCAACAGTCAATGTCTTCAGGTTC Harris et al., 1998, PMID: 9705406 N/A
Primer: DENV1–4, TS1: 5'-CGT CTC AGT GAT CCG GGG G Harris et al., 1998, PMID: 9705406 N/A
Primer: DENV1–4, TS2: 5'-CGCCAC AAG GGC CAT GAA CAG Harris et al., 1998, PMID: 9705406 N/A
Primer: DENV1–4, TS3: 5'-TAA CAT CAT CAT GAG ACAGAG C Harris et al., 1998, PMID: 9705406 N/A
Primer: DENV1–4, DEN4: 5'-TGT TGT CTT AAA CAA GAG AGG TC Harris et al., 1998, PMID: 9705406 N/A
Primer: DENV UNC 3009 Forward: GGACTGGATACACGCACCCA This manuscript N/A
Primer: DENV UNC 3009 Reverse: CATGTCTCTACCTTCTCGACTTGTCT This manuscript N/A
DENV UNC 3009 Probe: ACCTGGATGTCGGCTGAAGGAGCTTG This manuscript N/A
TaqMan™ Rodent GAPDH Control Reagents Applied Biosystems Cat. 4308313
Software and Algorithms
GraphPad Prism 7.2 GraphPad Software, Inc. https://www.graphpad.com
PyMOL Schrödinger, LLC https://www.pymol.org/
Other
ÄKTA pure chromatography system GE Healthcare Life Sciences N/A
EL406 washer dispenser BioTek N/A
Biostack microplate stacker BioTek N/A
HiTrap Protein G High Performance GE Healthcare Life Sciences Cat# 17–0404-01
Immunospot CTL N/A