Table 3.
Probes for detection of tet(X3) and tet(X4) genes
| Probe | Sequence (5′-3′) | Gene | Accession No. | Reference |
|---|---|---|---|---|
| tet(X3)-P | AAGATTTTCCAAATGGAGTGAAG | tet(X3) | MK134375.1 | This study |
| tet(X4)-P | TCGTGTGACATCATCT | tet(X4) | MK134376.1 | This study |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.