Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2020 Apr 7;177(14):3327–3341. doi: 10.1111/bph.15052

Low‐concentration DMSO accelerates skin wound healing by Akt/mTOR‐mediated cell proliferation and migration in diabetic mice

Wei Guo 1,2,[Link], Wei Qiu 1,2,[Link], Xiang Ao 1,2, Weiqiang Li 1,3, Xiao He 1,2, Luoquan Ao 1,2, Xueting Hu 1,2, Zhan Li 1,2, Ming Zhu 1,2, Donglin Luo 4, Wei Xing 1,2,✉, Xiang Xu 1,2,3,✉
PMCID: PMC7312275  PMID: 32167156

Abstract

Background and Purpose

DMSO has been found to promote tissue repair. However, the role of DMSO in diabetic skin wound healing and the underlying molecular mechanisms are still unclear.

Experimental Approach

The effects of DMSO on wound healing were evaluated by HE staining, immunohistochemistry and collagen staining using a wound model of full‐thickness skin resection on the backs of non‐diabetic or diabetic mice. Real‐time cell analysis and 5‐ethynyl‐2′‐deoxyuridine incorporation assays were used to study the effect of DMSO on primary fibroblast proliferation. A transwell assay was used to investigate keratinocyte migration. The associated signalling pathway was identified by western blotting and inhibitor blocking. The effect of DMSO on the translation rate of downstream target genes was studied by RT‐qPCR of polyribosome mRNA.

Key Results

We found that low‐concentration DMSO significantly accelerated skin wound closure by promoting fibroblast proliferation in both nondiabetic and diabetic mice. In addition, increased migration of keratinocytes may also contribute to accelerated wound healing, which was stimulated by increased TGF‐β1 secretion from fibroblasts. Furthermore, we demonstrated that this effect of DMSO depends on Akt/mTOR‐mediated translational control and the promotion of the translation of a set of cell proliferation‐related genes. As expected, DMSO‐induced wound healing and cell proliferation were impaired by rapamycin, an inhibitor of Akt/mTOR signalling.

Conclusion and Implications

DMSO can promote skin wound healing in diabetic mice by activating the Akt/mTOR pathway. Low‐concentration DMSO presents an alternative medication for chronic cutaneous wounds, especially for diabetic patients.

Abbreviations

4EBP1

eukaryotic translation initiation factor 4E binding protein 1

EdU

5‐ethynyl‐2′‐deoxyuridine

eIF4E

eukaryotic translation initiation factor 4E

mTOR

mechanistic target of rapamycin kinase

p‐4EBP1

phosphorylated 4EBP1

p‐Akt

phosphorylated protein kinase B

p‐mTOR

phosphorylated mTOR

p‐p70S6K

phosphorylated p70S6K

RTCA

real‐time cell analysis

What is already known

  • DMSO has a beneficial effect on wound healing and tissue repair.

What this study adds

  • DMSO promotes chronic wound healing in nondiabetic and diabetic mice.

  • The pharmacological mechanism of DMSO involves Akt/mTOR‐mediated translational regulation.

Clinical significance

  • Low‐concentration DMSO may be an alternative treatment for chronic cutaneous wounds in diabetic patients.

1. INTRODUCTION

According to a report, an estimated 422 million adults are living with diabetes globally and the global prevalence (age‐standardized) of diabetes has nearly doubled since 1980, rising from 4.7% to 8.5% in the adult population (World Health Organization, 2016). Thus, the global prevalence of diabetes has been rapidly increasing in recent years and is expected to further increase to 642 million by 2040 (NCD Risk Factor Collaboration, 2016; Ogurtsova et al., 2017; Whiting, Guariguata, Weil, & Shaw, 2011). Diabetic patients frequently suffer from severely impaired wound healing, along with a 15–25% lifetime risk of diabetic skin ulcerations (Singh, Armstrong, & Lipsky, 2005) and 15–27% of diabetic foot ulcer cases will undergo lower extremity amputation due to a high rate of treatment failure (Situm, Kolic, Redzepi, & Antolic, 2014). Currently, treatment for diabetic wounds is still limited to blood glucose control, antibiotics, vasodilators such as PGE, neural protection by vitamin B, hyperbaric oxygen to improve microcirculation, local debridement, negative pressure therapy, surgical vascular reconstruction and amputation. However, none of these treatments can achieve satisfactory outcomes (Lim, Ng, & Thomas, 2017). Therefore, an efficacious strategy is urgently required for the prevention and treatment of diabetic cutaneous wounds.

Impaired diabetic wound healing is characterized by significant impairments in cell proliferation and migration and a dramatic reduction in protein synthesis, which lead to delayed re‐epithelialization, angiogenesis and formation of granulation tissue (Huang et al., 2015; Lim et al., 2017). Studies have shown that various molecular pathways are involved in cell proliferation and protein synthesis during wound healing. Among them, the mammalian target of the sirolimus (rapamycin) signalling pathway mTOR seems to have particular importance in diabetic wound healing, as several upstream activators and downstream effectors of mTOR are down‐regulated in diabetic wounds (Goren et al., 2009; Laplante & Sabatini, 2012).

DMSO is extensively used in biological studies as a polar aprotic solvent and cryoprotectant and as a topical analgesic, a vehicle for topical application of pharmaceuticals, an anti‐inflammatory agent and an antioxidant (Elisia et al., 2016; Russo & Santarelli, 2016). Several studies have reported that DMSO promoted wound healing in soft tissue damage, skin ulcers and burns (Alberts & Dorr, 1991; Lebredo, Barrie, & Woltering, 1992), but others reported opposing results (Huu & Albert, 1966).

In the present study, we explored the in vitro and in vivo roles and molecular mechanisms of DMSO in the proliferation and migration of primary skin fibroblasts and keratinocytes. Moreover, we focused on the role of Akt/mTOR signalling in DMSO‐accelerated diabetic chronic skin wound healing and we showed that low‐concentration DMSO activates Akt/mTOR signalling and enhances cap‐dependent mRNA translation in diabetic skin wounds and primary skin fibroblasts, leading to enhanced fibroblast proliferation and wound healing.

2. METHODS

2.1. Genetically modified mice

Animal studies are reported in compliance with the ARRIVE guidelines (McGrath & Lilley, 2015) and with the recommendations made by the British Journal of Pharmacology. All animal experiments were conducted in accordance with principles approved by the Ethics Committee on Animal Experiments, Army Medical University, China. Diabetic B6. BKS(D)‐Lepr db/J mice (Jackson Laboratory, Bar Harbor, ME, USA) and nondiabetic C57BL/6J mice were provided by the Laboratory Animal Center of Daping Hospital, Army Medical University, China. Mice were group housed at room temperature (20–25°C) in a 12‐h light/dark cycle in sterile cages with free access to standard food and water. Genetically modified mice were ear‐tagged and the terminal 2–3 mm of their tails were clipped for genotyping. Briefly, DNA was extracted from the tail snips using a Mouse Tail Genomic DNA Kit (CW Bio, Beijing, China) and amplified by PCR. Then, genotyping was performed by direct sequencing of the PCR‐amplified DNA (primers of the mouse leptin receptor, sequence 5′ to 3′ Forward: AGAACGGACACTCTTTGAAGTCTC, Reverse: CCCTGAAAATCAAGCATATGTCC). Based on the results, mice heterozygous for a mutation in the Lepr gene (Lepr db/+ mice) were interbred to produce homozygous (Lepr db/db), heterozygous (Lepr db/+) and WT (Lepr +/+) mice.

2.2. Skin wound healing assay and sirolimus/rapamycin administration in vivo

Ten‐week‐old mice were used to construct the wound model. A round full‐thickness skin excisional wound (1 cm in diameter) was made on the back of each mouse. The wound was covered with a piece of 1 cm × 1 cm filter paper and 50 μl of saline‐diluted DMSO (Solarbio, Beijing, China) or saline was added for even distribution of the agents. The filter paper was kept there for 10 min each time and the procedure was repeated every 24 h until the wound was healed. The rate of wound closure was compared between each group every day. Skin wound biopsy specimens were obtained on Days 0, 5, 8, 11, 13, 15 and 18 after injury. The specimens were ground in liquid nitrogen and lysed with lysis buffer (20‐mM Tris [pH 7.5], 150‐mM NaCl, 1% Triton X‐100, 1‐mM sodium pyrophosphate, 1‐mM β‐glycerophosphate, 10‐mM Na3VO4 and protease inhibitor cocktail tablets [Roche, Basel, Switzerland] for immunoblotting analysis).

In vivo inhibition of mTOR signalling by sirolimus (rapamycin; Santa Cruz, CA, USA) was performed as previously described with some modifications (Zhao et al., 2017). Sirolimus/rapamycin was resolved in absolute ethanol to 10 mg·ml−1 and stored at −20°C. The sirolimus/rapamycin was diluted to 2 mg·ml−1 in normal saline before use. The wound was covered with a piece of 1 cm × 1 cm filter paper and 100 μl of saline‐diluted sirolimus/rapamycin (2 mg·ml−1) or saline‐diluted ethanol (20%) was added for even distribution of the agents. The filter paper was kept there for 30 min each time. Next, 50 μl of saline‐diluted DMSO (Solarbio, Beijing, China) or saline was added and incubated for another 10 min each time. The procedure was repeated every 24 h until the wound was healed. The rate of wound closure was compared between groups every day.

2.3. Culture of mouse primary fibroblasts and primary keratinocytes

For fibroblast culture, primary fibroblasts were isolated from the back skin of newborn mice, as described by Liu, Hossain, Chen, and Jin (2017). In brief, newborn mice aged 1–2 days were killed and soaked in 70% ethanol for 3–5 min and the skin was obtained under sterile conditions. In a 60‐mm culture dish, the skin was cut into pieces and 10 ml of 0.25% trypsin was added (Invitrogen, Carlsbad, CA, USA) with 50 U·ml−1 DNase I (Sigma, St. Louis, MO, USA); a bar‐type pipe was used for even mixing and the sample was placed in a culture bottle (25 cm2) in a 37°C water bath incubator with shaking for 20 min. The tissue suspension was repeatedly passed through a 40‐μm cell mesh and the cell suspension was centrifuged for 5 min at 200× g and then cultured in 10 ml of DMEM (BI, Kibbutz Beit Haemek, Israel) containing 10% FBS (BI, Kibbutz Beit Haemek, Israel) at 37°C with 5% CO2.

Keratinocytes were isolated from neonatal mouse skin, as described by Li, Adase, and Zhang (2017). The postnatal day 0–2 neonates were killed and the whole‐body skin was peeled off. The peeled skins were rinsed with sterile PBS and incubated in 4 mg·ml−1 dispase (Invitrogen, Carlsbad, CA, USA) in KC growth medium (Invitrogen, Carlsbad, CA, USA) overnight in a 4°C refrigerator on a rotator. The epidermis was separated and incubated in trypsin (Invitrogen, Carlsbad, CA, USA) solution in a new petri dish at room temperature for 20 min. The epidermis was grasped using forceps and we vigorously rubbed the epidermis back and forth to release single cells from the epidermal sheet. The cell suspensions were collected, filtered and centrifuged for 5 min at 180× g. Then, 1.5 × 106 cells were seeded in KC growth medium in culture dishes (25 cm2). All experiments were performed using cells from the third to the fifth passages.

2.4. Cell viability assay

When the inoculated primary fibroblasts in 96‐well plates had attached to the bottom of the plates or were in the mid‐logarithmic growth phase, the medium was replaced with DMEM containing different concentrations of DMSO. After treatment for the indicated period, cell viability was measured using the Cell Counting Kit‐8 (Beyotime, Haimen, Jiangsu, China) according to the manufacturer's instructions. Briefly, 15 μl of cell counting kit‐8 solution was added to each well and incubated at 37°C for 1 h. Then, the absorbance at 450 nm was measured using a microplate reader (BioTek Instruments; Winooski, VT, USA).

2.5. Transwell migration assays

To assess the cell migration ability in vitro, we performed a transwell migration assay using a transwell chamber (8‐μm pores, Corning Star; Cambridge, Mass, USA) as previously reported (Zhao et al., 2019). Briefly, cells (1 × 105 keratinocytes) were seeded in the top chamber with 100 μl of serum‐free medium and 600 μl of medium containing 10% FBS was added to the bottom chamber. According to the stimulants added to the medium in the bottom chamber, six experimental groups were established: PBS control, DMSO (5 mM), recombinant mouse TGF‐β1 (5 ng·ml−1, R&D Systems, Minnesota, USA), mouse fibroblasts (MFs, 4 × 105 cells), MF + DMSO and MF + DMSO+1D11 (a TGF‐β1 (TGFBR1) neutralizing antibody, 10 g·ml−1, R&D Systems, Minnesota, USA). PBS control or 5‐mM DMSO was added to the medium in the top chamber. After 24 h of incubation, keratinocytes were fixed with 100% methanol and stained with crystal violet (0.1%). Cells were quantified as the average number of cells found in five random microscopic fields. Three repeated experiments were executed.

2.6. Immunohistochemistry (HE staining, immunohistochemistry and collagen staining)

The animals were killed on the eighth and 15th days after modelling and complete wound tissue was separated from the back. The paraffin‐embedded tissue was subjected to HE or immunohistochemistry staining through a standard procedure. Then, the nucleus was stained with haematoxylin and collagen was stained with Masson's trichrome stain.

2.7. Luciferase reporter gene assay

A translational reporter assay was performed as previously described (Xu, Vatsyayan, Gao, Bakkenist, & Hu, 2010). Primary fibroblasts from mouse skin were plated in a 6‐well plate and transfected with the luciferase reporter gene plasmids when the cells reached 60% confluence. After 8 h, the medium was replaced with fresh DMEM medium with DMSO or PBS control. The cells were lysed 24 h after transfection and luciferase assay reagent (Beyotime, Shanghai, China) was added. The fluorescence values were read by a bioluminescence detector (GLOMAX20/20, Promega, WI, USA). The protein concentration of each well was measured and used for normalizing luciferase activity.

2.8. Pull‐down assays with 7mGTP

The 7mGTP Sepharose™ 4B beads (GE Healthcare, IL, USA) were used for the pull‐down assay. Total protein (0.5 mg) was thoroughly mixed with 10‐μl 7mGTP Sepharose™ 4B beads and incubated at 4°C for 12 h. The mixture was washed three times with lysis buffer and the precipitated proteins were dissociated from the 7mGTP matrix by boiling in SDS loading buffer. The suspension was loaded onto SDS‐PAGE for immunoblotting with antibodies against eukaryotic translation initiation factor 4E (eIF4E) and 4G (eIF4G) (CST, Shanghai, China). Whole cell lysates were used as loading controls. All experiments were repeated independently five times.

2.9. Immunoblotting

The immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology. Tissue or cell samples were lysed in lysis buffer (20‐mM Tris [pH 7.5], 150‐mM NaCl, 1% Triton X‐100, 1‐mM sodium pyrophosphate, 1‐mM β‐glycerophosphate, 10‐mM Na3VO4 and protease inhibitor cocktail tablets [Roche, Basel, Switzerland]). The homogenate was centrifuged at 12,000 rpm for 15 min at 4°C. Protein concentration was determined using a BCA Protein Assay Kit (Biosharp, Hefei, Anhui, China). Equal amounts of the extract were subjected to SDS‐PAGE and transferred to PVDF membranes. After the membranes were blocked with 5% fat‐free milk in Tris‐buffered saline with 0.1% Tween 20 (TBST) for 60 min, the membranes were incubated overnight at 4°C with specific primary antibodies (listed in Table S2), as indicated in the figure legends. After three washes with TBST, the membranes were incubated with an HRP‐conjugated secondary antibody (1:10,000; Zhongshan Goldenbridge, Beijing, China) for 60 min at 37°C. Following an additional three washes with TBST, the protein bands were revealed by an ECL luminescent detection system (GE Healthcare, IL, USA).

2.10. Incorporation of 5‐ethynyl‐2′‐deoxyuridine (EdU)

Proliferation of mouse primary fibroblasts was analysed by an EdU DNA Proliferation in vitro Detection Kit (RiboBio, Guangzhou, Guangdong, China). First, 50‐μM EdU was added to the culture in a 96‐well plate and incubated for 2 h. After the cells were washed with PBS for 5 min two times, they were fixed with 4% paraformaldehyde for 30 min, incubated in 2 mg·ml−1 glycine for 5 min and perforated with 0.5% Triton X‐100. After another wash with PBS, the cells were stained with Apollo 488 staining agent and Hoechst 33342 as instructed by the manufacturer and observed immediately.

2.11. Real‐time cell analysis (RTCA)

A RTCA system (ACEA Biosciences, Hangzhou, Zhejiang, China) that continuously measures the impedance‐based signal of attached cells and presents the signals as a cell index was used to continuously monitor the effects of different culture conditions on the adherence and proliferation of primary mouse fibroblasts. For baseline inspection and quality control, 50 μl of complete culture medium was added to each well of the E‐Plate‐16, which was placed onto the xCELLigence RTCA‐DP instrument in a standard CO2 cell culture incubator to read the cell index values. Then, 200 μl of primary mouse fibroblast suspension (1 × 104 cells·ml−1) was added to each well without removing the initial 50 μl of medium and the cell index values of each well were continuously monitored every 10 min.

2.12. Polysome separation and reverse transcription‐quantitative PCR (RT‐qPCR)

At 80% confluence, cells were washed with 0.9% NaCl and treated with 100 μg·ml−1 cyclohexamide (Sigma, St. Louis, MO, USA) in 0.9% NaCl on ice for 10 min. Cells from two 10‐cm plates were scraped and incubated in 500‐μl lysis buffer for 30 min on ice. Lysates were centrifuged at 10,000 rpm for 5 min at 4°C and supernatants were loaded onto a 10–50% sucrose gradient with 1‐mM DTT, 100 μg·ml−1 cyclohexamide and 40 U·ml−1 RNasin. Samples were centrifuged at 40,000 rpm for 2.5 h at 4°C (Beckman Coulter, SW41 Ti rotor) and then separated on a BIOCOMP gradient fractionation system (Fredericton, Canada) to evaluate polysome profiles and collect polysome fractions. RNA was isolated from polysome fractions using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and analysed by RT‐qPCR for the indicated genes. All primers for RT‐qPCR assay are shown in Table S1. Three sets of experiments were performed independently.

2.13. Statistical analysis

For all statistically evaluated studies, at least five separate experiments were performed. The experiments were performed in a randomized manner. The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018) and the data analysis were performed in a blinded manner. Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software, San Diego, CA, USA). Data are expressed as mean ± SEM of n independent experiments performed in triplicate. Statistical significance among different treatments was assessed by Student's t‐test or one‐way ANOVA with Kruskal–Wallis multiple comparisons test if more than two treatment groups were compared. Statistical significance was defined as P < 0.05.

2.14. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018) and are permanently archived in the Concise Guide to PHARMACOLOGY 2019/20 (Alexander et al., 2019).

3. RESULTS

3.1. DMSO promoted skin wound healing and fibroblast proliferation in nondiabetic mice at low concentrations

A round full‐thickness skin excision wound was made in the back of C57BL/6J mice and the wound of each mouse was treated with 0.05 ml of DMSO solution (in physiological saline) at different concentrations every 24 h (Figure 1a). Compared with the control, DMSO significantly accelerated wound closure at low concentrations, especially 5 mM, but delayed wound healing at high concentrations (20 mM) (Figure 1b). Cell proliferation in the wound bed was then evaluated by western blot against the proliferation‐related nuclear protein Ki‐67, which was significantly enhanced by DMSO treatment on Days 5, 8 and 11 (Figure 1c). We also treated primary skin fibroblasts of nondiabetic mice with DMSO at different concentrations and analysed cell proliferation by cell counting kit‐8 assays. We found that DMSO promoted the in vitro proliferation of primary fibroblasts at low concentrations, most obviously at 5 mM, but inhibited growth and proliferation at high concentrations (Figure 1d). However, DMSO did not affect the in vitro proliferation of primary keratinocytes (Figure S1A) or the migration of primary keratinocytes and fibroblasts (Figures 1e and S1B, C). These results suggested that an appropriate concentration of DMSO could induce skin fibroblast proliferation and wound healing in nondiabetic mice.

FIGURE 1.

FIGURE 1

Open in a new tab

DMSO treatment accelerates normal skin wound healing and fibroblast proliferation but shows no direct effect on keratinocyte migration in vitro. Round, full‐thickness skin excisional wounds were made on the backs of C57BL/6J mice, followed by treatment with normal saline or DMSO at a series of concentrations every day until the wound was healed. (a) Flowchart of animal experiments. (b) Percentage of wound closure in each group, calculated as (A0 − Ai)/A0 × 100% (A0: area of wound on day 0; Ai: area of wound on Day 1). Data are presented as the mean ± SEM with n = 12 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. (c) Ki67 expression in the wound tissue of mice treated with 0.05 ml of 5‐mM DMSO or normal saline. The integrated OD (IOD) of the protein band was calibrated with GAPDH. Data are presented as the mean ± SEM with n = 6 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. NS, not significant. (d) Mouse primary fibroblasts were treated with DMSO at a given concentration and cell proliferation was determined by cell counting kit‐8 assays. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the normal saline control. (e) Scratch wound healing assay of mouse primary keratinocytes treated with 5‐mM DMSO or vehicle control

3.2. DMSO promoted skin wound healing and fibroblast proliferation in diabetic mice

To further evaluate the effect of DMSO on wound healing in diabetic mice, we used the same skin wound model in diabetic B6.BKS(D)‐Leprdb/J mice. The diabetic wound and fibroblasts were treated with a finer range of DMSO concentrations including 1, 2.5, 5, 7.5, 10, 15 and 20 mM. The results showed that 5‐mM DMSO significantly promoted diabetic wound healing and fibroblast proliferation compared to those of the control group (Figure S2A, B). From Day 6 after wounding, mice in the DMSO group showed significantly higher wound closure rates and reached full closure earlier (Figure 2a). Although the rate of wound healing in DMSO‐treated diabetic mice was significantly improved, it was some slower than that in normal mice (Figure S2C). Pathological sections of wounds 13 days after wounding showed that the degree of wound healing and collagen deposition in the DMSO group were better than those in the control group (Figure 2b). We evaluated the molecular markers (such as collagen, α‐SMA, ki67 and TGF‐β1 related to wound healing by both immunohistochemistry and western blot analysis, which also suggested accelerated healing (Figures 2c, d). Primary skin fibroblasts derived from diabetic mice were treated with DMSO, followed by RTCA (Figure 2e) and EdU incorporation assays (Figure 2f, g). These results suggested that DMSO, at an appropriate concentration, could also induce skin primary fibroblast proliferation, collagen synthesis and chronic wound healing in diabetic mice.

FIGURE 2.

FIGURE 2

Open in a new tab

Diabetic skin wound healing and diabetic fibroblast proliferation is also accelerated by DMSO treatment. A round, full‐thickness skin excisional wound was made on the back of B6. BKS(D)‐Leprdb/J mice, followed by treatment with 0.05 ml per mouse of 5‐mM DMSO or normal saline every day until the wound was healed. (a) Percentage of wound closure in each group, calculated as (A0 − Ai)/A0 × 100% (A0: area of wound on day 0; Ai: area of wound on Day 1). Data are presented as the mean ± SEM with n = 12 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. (b) H&E and Masson's trichrome staining of the DMSO‐treated and untreated wounds 13 days after injury. The black scale bar represents 200 μm original magnification ×40; the white scale bar represents 50 μm original magnification ×200. The right histogram is a statistical assay of collagen area in the wound. Data are presented as the mean ± SEM with n = 6 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. (c) Immunochemistry staining of wound healing‐related proteins, such as collagen, a‐SMA, ki‐67 and TGF‐β1, in the wound tissue 13 days after injury (n = 6). Scale bars represent 100 μm; original magnification ×100. The “former” wound margins were indicated with dotted lines. The arrow points to the wound area. (d) Western blot of wound healing‐related proteins in the wound tissue 13 days after injury. Numbers present the IOD of protein bands, which was calibrated with GAPDH. Data are presented as the mean ± SEM with n = 6 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. (e) Real‐time cell assessment (RTCA) to determine the growth of diabetic mouse‐derived primary fibroblasts treated with or without DMSO (n = 5). (f) EdU incorporation in diabetic mouse‐derived primary fibroblasts (n = 5). Scale bars represent 50 μm; original magnification ×200. (g) Percentage of EdU‐positive cells in Figure 2f. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t‐test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group

3.3. DMSO indirectly promoted keratinocyte migration via increased TGF‐β1 (TGFBR1) secretion by fibroblasts

Since keratinocyte migration may also contribute to wound healing, we evaluated the effect of DMSO on keratinocyte migration. First, we tested the migration of primary keratinocytes derived from diabetic mice by transwell assays. We found that 5‐mM DMSO had no significant direct effect on keratinocyte migration per se (Figure 3a). However, the increased length of the epithelial tongue in DMSO‐treated wounds suggested that DMSO had an indirect effect on keratinocyte migration (Figure 3b). Many studies have demonstrated that TGF‐β1 secreted by fibroblasts has an ability to promote keratinocyte migration (Asrani et al., 2017), so we tested the role of TGF‐β1 in DMSO‐mediated keratinocyte migration. Immunofluorescence assays suggested that DMSO treatment increased TGF‐β1 expression in the wound (Figure 3c). The migration of the primary keratinocytes was accelerated by TGF‐β1 alone (5 ng·ml−1) (Figure 3a) or by coculture with fibroblasts combined with DMSO treatment, but this migratory effect was inhibited by a TGF‐β1 blocking antibody (10 μg·ml−1 1D11) (Figure 3d). Increased keratinocyte migration was also supported by molecular markers (Figure 3e). These results suggested that DMSO indirectly promotes keratinocyte migration via increased TGF‐β1 secretion by fibroblasts.

FIGURE 3.

FIGURE 3

Open in a new tab

DMSO promotes the migration of diabetic mouse‐derived primary keratinocytes in an indirect manner mediated by fibroblast‐derived TGF‐β1. (a) Migration of the keratinocytes by transwell assays after treatment with or without 5‐mM DMSO or TGF‐β1 for 24 h. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. NS, not significant. (b) Representative H&E‐stained sections of wound tissue 8 days after injury. The arrow indicates the length of the migrating epithelial tongue. Data are presented as the mean ± SEM with n = 6 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. Scale bars represent 100 μm; original magnification ×100. (c) Immunofluorescence staining of TGF‐β1 in DMSO‐treated and untreated wound tissue (n = 6). Scale bars represent 50 μm; original magnification ×200. (d) Migration of keratinocytes treated as indicated. MF, cocultured with mouse fibroblasts by a transwell assay; 1D11, a TGF‐β1 neutralizing antibody. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the MF group, (e) western blot of migration‐related proteins in the keratinocytes treated as indicated

3.4. DMSO activated Akt/mTOR signalling and enhanced the formation of the translation initiation complex

To further explore the molecular mechanism by which DMSO promoted wound healing and fibroblast proliferation, we used DMSO to treat with primary skin fibroblasts derived from both nondiabetic and diabetic mice and probed western blots for components of the Akt/mTOR signalling pathway, which plays an essential role in cell growth and proliferation. We found that Akt/mTOR signalling (phosphorylation of Akt (Thr308) and mTOR (Ser2448)) was less active in primary fibroblasts from diabetic mice than in those from nondiabetic mice, while treatment with DMSO significantly up‐regulated p‐Akt and p‐mTOR levels in primary fibroblasts from both diabetic and nondiabetic mice but did not significantly change the total Akt and mTOR expression (Figure 4a). We further examined mTOR activation by DMSO at different time points and changes in downstream signalling molecules. Immunoblotting demonstrated that phosphorylation of Akt (p‐Akt), phosphorylation of mTOR (p‐mTOR) and two specific downstream target proteins, phosphorylated 4EBP1 (p‐4EBP1) and phosphorylated p70S6K (p‐p70S6K), significantly increased in diabetic primary fibroblasts 1 h after DMSO treatment and peaked at 12–24 h (Figure 4b). A cap‐dependent luciferase assay also suggested that DMSO activated cap‐dependent translation in primary skin fibroblasts derived from diabetic mice (Figure 4c). Previous research has confirmed that phosphorylated 4EBP1 disassociated from the inactive translation initiation eIF4F complex, which accelerated eIF4E binding to eIF4G and enhanced the formation of active eIF4F (Xu et al., 2010). The results in Figure 4b showed that DMSO can induce phosphorylation of 4EBP1. Accordingly, the 7mGTP pull‐down assays in vitro and in vivo suggested that DMSO treatment can reduce the content of 4EBP1 and increase the content of eIF4E in the eIF4F complex (Figures 4d and S3A, B). Together, these results suggest that DMSO enhances the phosphorylation of Akt and mTOR, promotes the formation of the active eIF4F complex and enhances protein translation.

FIGURE 4.

FIGURE 4

Open in a new tab

Activation of the Akt/mTOR signalling pathway and translation initiation complex formation in nondiabetic and diabetic mouse primary fibroblasts after DMSO treatment. (a) Total and phosphorylated Akt (T308) and mTOR were determined by western blots of NMFs and DMFs treated with or without 5‐mM DMSO for 24 h. The IOD of the protein band was calibrated with GAPDH. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the corresponding control group. NS, not significant. (b) DMFs were treated with or without 5‐mM DMSO for 0–48 h. p‐Akt (T308), p‐mTOR, p‐4EBP1 and p‐p70S6K were detected by western blot analyses. (c) DMSO induces translation‐dependent luciferase expression in the DMFs. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. (d) Active eIF4F was measured by 7mGTP pull‐down assays in the DMFs. The IOD of the protein band was calibrated with input. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group. NS, not significant. NMF, nondiabetic mouse skin‐derived primary fibroblasts. DMF, diabetic mouse skin‐derived primary fibroblasts

3.5. DMSO‐promoted proliferation of fibroblasts largely relied on Akt/mTOR activation

To evaluate the contribution of the Akt/mTOR signalling pathway to DMSO‐enhanced wound healing, we further treated cultured fibroblasts and mouse wounds with sirolimus/rapamycin (a specific inhibitor of mTOR). An EdU incorporation assay demonstrated that DMSO‐induced diabetic mouse skin primary fibroblast proliferation was significantly inhibited by sirolimus/rapamycin (Figure 5a) and RTCA revealed similar results (Figure 5b). Consistently, the DMSO‐induced increase in LUC translation was impaired by sirolimus/rapamycin (Figure 5c). Immunoblotting also showed that rapamycin inhibited the effect of DMSO on the phosphorylation of p70S6K and 4EBP1 and the formation of the active translation initiation complex eIF4F (Figure 5d). Skin wound closure was also delayed in sirolimus/rapamycin‐treated mice, countering the effect of DMSO (Figures 5e,f). The analysis of mTORC2 signalling pathway showed that DMSO could not enhance the phosphorylation of Akt (Ser473), a target of mTORC2 signalling in wound tissues and consistent with previous reports, chronic rapamycin treatment could inhibit Akt (Ser473) phosphorylation (Sarbassov et al., 2006). Moreover, DMSO could partially relieve the inhibition effect of sirolimus/rapamycin on the expression of mTORC1 target phosphorylated S6 (P‐S6). More importantly, co‐immunoprecipitation results showed that DMSO enhanced the formation of active mTORC1 complex by increasing the Raptor–mTOR interaction but did not increase the level of Rictor in the mTORC2 complex (Figure 5g). These results demonstrate that DMSO improved wound healing by activating mTORC1 but not mTORC2. Together, these results suggested that activation of Akt/mTORC1 is necessary for DMSO‐induced cell proliferation and translational activation in diabetic primary skin fibroblasts and is thus vital in DMSO‐promoted skin wound healing.

FIGURE 5.

FIGURE 5

Open in a new tab

The Akt/mTOR signalling pathway is necessary for DMSO‐induced fibroblast proliferation. DMFs were cotreated with or without DMSO (5 mM) and sirolimus/rapamycin; 0.1 μM). (a) EdU incorporation assay. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. NS, not significant. (b) Real‐time cell assessment to evaluate cell proliferation and viability (n = 5). (c) Translation‐dependent luciferase expression assay. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. NS, not significant. (d) Western blots of p‐mTOR, p‐S6, p‐4EBP1 and p‐p70S6K in DMFs (n = 5). A 7mGTP pull‐down assay was used to assess eIF4F formation. Numbers present the IOD of protein bands, which was calibrated with GAPDH or input. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. (e) The effect of chronic topical application of sirolimus/rapamycin combined with DMSO on skin wound closure in diabetic mouse (n = 12). Round, full‐thickness skin excisional wounds were made on the backs of B6. BKS(D)‐Leprdb/J mice, followed by treatment with 0.05 ml per mouse of 5‐mM DMSO combined with 0.1 ml per mouse of 2 mg·ml−1 sirolimus/rapamycin or vehicle control every day until the wound was healed. (f) Percentage of wound closure in each group, calculated as (A0 − Ai)/A0 × 100% (A0: area of wound on Day 0; Ai: area of wound on Day 1). Data are presented as the mean ± SEM with n = 12 for all groups, analysed by Student's t test. Significance level: *P < 0.05, 5‐mM DMSO versus the control group; # P < 0.05, RM versus the control group. △ P < 0.05, 5‐mM DMSO combined with RM versus the RM group. (g) The effect of chronic sirolimus treatment combined with DMSO on mTORC1 and mTORC2 signalling key molecules in wound tissues. At 13 days after wounding, the expressions of p‐Akt (S473), p‐mTOR and p‐S6 were detected by western blot. The Raptor–mTORC1 and Rictor–mTORC2 complex were determined by co‐immunoprecipitation. Numbers present the IOD of protein bands, which was calibrated with GAPDH. Data are presented as the mean ± SEM with n = 6 for all groups, analysed by one‐way ANOVA with Kruskal–Wallis test for multiple comparison. Significance level: * P < 0.05, compared with the control group. RM, sirolimus/rapamycin

3.6. DMSO promoted the translation of a set of proliferation‐related genes in fibroblasts

To clarify how DMSO promoted cell proliferation, we selected 19 proliferation‐related genes and determined changes in their total mRNA level and polysome‐bound mRNA levels as previously described (Truitt et al., 2015). DMSO had no significant effect on the total mRNA levels of these genes but led to significant enrichment of a set of mRNAs in the polysome (Figure 6b). For those genes with over a twofold increase in polysome‐bound mRNA after DMSO treatment, including ATG‐13, CyclinD1, c‐Myc, TGF‐β1 and XIAP, translation efficiency was calculated (polysome‐bound mRNA/total mRNA, GAPDH as internal control) and increased translation efficiency was observed for all these genes (Figure 6c). These results were further confirmed by western blots (Figure 6d). Among these genes, the translation efficiency increase for the TGF‐β1 gene is greater than that for the other genes (Figure 6b–d). This difference may be caused by the differentiated eIF4E response translation motifs in the 5′‐noncoding sequences of genes, which lead to different binding capacities for eIF4F and different translation efficiencies (Truitt et al., 2015).

FIGURE 6.

FIGURE 6

Open in a new tab

DMSO promotes the translation of a set of genes related to cell proliferation in diabetic mouse primary fibroblasts. Diabetic mouse primary fibroblasts (DMF) were treated with or without 5‐mM DMSO for 24 h and T‐mRNA and P‐mRNA were extracted using sucrose‐gradient polysome analysis. Both T‐mRNAs and P‐mRNAs related to cell proliferation were tested by qRT‐PCR. (a) Polysome profiling. Sections 8–12 were collected. (b) Induction of fibroblast T‐mRNA and P‐mRNA by DMSO, shown as a heat map. (c) Translation efficiency of the major genes of interest, calculated as the level of P‐mRNA divided by the level of T‐mRNA. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t test. Significance level: *P < 0.05, DMFs treated with DMSO versus DMFs treated without DMSO. (d) Immunoblotting of proteins of interest in DMFs treated with or without DMSO. Numbers present the IOD of protein bands, which was calibrated with GAPDH. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t test. Significance level: *P < 0.05, DMFs treated with DMSO versus DMFs treated without DMSO. T‐mRNA, total mRNA; P‐mRNA, polysome‐bound mRNA

In addition, many soluble factors (such as EGF, insulin‐like growth factor 1 [IGF‐1] and CXCL10) secreted by fibroblasts and keratinocytes also play important roles in the re‐epithelialization process during wound healing. Therefore, the secretory expression of these three soluble factors was also detected. Our results found that DMSO only increased the secretory expression of CXCL10 but did not affect the expression of EGF and IGF‐1 in fibroblast. In addition, the expression of these three soluble factors was not all affected by DMSO in keratinocytes (Figure S4A, B). These results suggested that CXCL10 may be involved in DMSO‐mediated wound healing.

4. DISCUSSION

As the incidence of diabetes increases yearly, diabetic foot ulcers and other refractory wounds have become a serious clinical problem. Drugs that promote diabetic wound healing are urgently needed. As an important polar aprotic solvent and cryoprotectant, DMSO has been widely used in pharmacology, biochemistry, cell biology and cryobiology. The anaesthetic, analgesic, anti‐inflammatory and antioxidant effects of DMSO have also been confirmed (Eberhardt et al., 1995; Hollebeeck et al., 2011; Russo & Santarelli, 2016). DMSO was reported to significantly promote wound healing, but opposite results were also published, which may be related to the different doses of DMSO used in the experiments (Alberts & Dorr, 1991; Goldblum, Alvarez, Mertz, & Eaglstein, 1983; Lebredo et al., 1992; Raposio & Santi, 1999). Our results confirmed that DMSO significantly promoted wound healing at low concentrations, especially at 5 mM, but delayed wound healing at higher concentrations in both nondiabetic and diabetic mice. The ability of low‐concentration DMSO to promote wound healing may involve a direct effect to enhance fibroblast proliferation, as suggested by our animal experiments and in vitro cell‐based assays.

We further sought to clarify the mechanism by which low‐concentration DMSO promotes wound healing. Wound healing is a complex process involving massive cell proliferation and migration, extracellular matrix synthesis and secretion, which are regulated by a variety of signalling pathways (Galkowska et al., 2006; Laplante & Sabatini, 2012; Qing, 2017). Akt/mTOR signalling plays an important role in energy metabolism, protein translation, cell proliferation and wound healing. Akt/mTOR signalling was shown to be activated during normal wound healing and weakened in refractory diabetic wounds (Huang et al., 2015; Kaur & Sharma, 2017; Saxton & Sabatini, 2017; Squarize, Castilho, Bugge, & Gutkind, 2010) Unsurprisingly, the mTOR inhibitor sirolimus/rapamycin significantly delayed normal wound healing, while polysaccharides, GM‐CSF, insulin and other agents that activate the Akt/mTOR signalling pathway and protein translation significantly promoted the healing of refractory diabetic wounds (Huang et al., 2015). However, there are also some contrasting reports; for example, mTORC1 signalling is activated in diabetic liver, heart and kidney tissue. mTORC1 hyperactivation is a key determinant for the development of diabetic nephropathy (Godel et al., 2011; Inoki et al., 2011), diabetic cardiomyopathy and hepatic insulin resistance (Korsheninnikova et al., 2006; Volkers et al., 2014). To evaluate the role of Akt/mTOR in DMSO‐induced wound healing, we determined the expression of key molecules or signalling activation of Akt (T308 and S473), mTOR (Raptor and Rictor) and the downstream proteins p70S6K, P‐S6 and 4EBP1 in primary mouse skin fibroblasts after treatment with 5‐mM DMSO. Our results suggested that low‐concentration DMSO‐induced phosphorylation of Akt and mTOR, as well as the downstream target proteins p70S6k, P‐S6 and 4EBP1, in fibroblasts derived from both nondiabetic and diabetic mice. Furthermore, our results showed that low‐concentration DMSO enhanced the formation of active mTORC1 complex by increasing the Raptor–mTOR interaction but did not increase the level of Rictor in the mTORC2 complex. These effects were accompanied by increased formation of the eukaryotic translation initiation complex eIF4F and enhanced translation of a set of proliferation‐related genes, suggesting an important role of the Akt/mTORC1 signalling pathway in DMSO‐induced wound healing. We further confirmed the role of the Akt/mTORC1 signalling pathway by cotreatment with sirolimus/rapamycin, a specific mTOR inhibitor that forms a complex with the intracellular receptor FKBP‐12 and binds to the FKBP‐12‐sirolimus/rapamycin‐binding (FRB) domain in mTOR (Squarize et al., 2010). Our results showed that sirolimus/rapamycin completely abolished DMSO‐induced Akt/mTORC1 activation and proliferation of primary fibroblasts derived from diabetic mice and animal experiments showed similar results. Therefore, our results suggest that DMSO promotes the proliferation of fibroblasts and refractory diabetic wound healing mainly by activating the Akt/mTORC1 pathway.

Furthermore, many studies have confirmed that the TGF‐β superfamily plays an important role in the biological processes required for normal wound healing and optimal scar formation (Kiritsi & Nystrom, 2018). Members of this family regulate a wide range of cellular functions, including proliferation, differentiation, apoptosis, extracellular matrix deposition, adhesion and migration (Kiritsi & Nystrom, 2018). TGF‐β1 production from fibroblasts was confirmed to drive epithelial–mesenchymal transition and migration in keratinocytes, which accelerates re‐epithelialization of wound healing (Cheng et al., 2016). Our results also demonstrated that DMSO can induce the expression of TGF‐β1 via increasing TGF‐β1 translation in fibroblasts. Additionally, keratinocytes treated with TGF‐β1 alone or cocultured with fibroblasts combined with DMSO treatment displayed an enhanced migratory phenotype. However, this DMSO‐induced migratory phenotype could be inhibited by anti‐TGF‐β1 neutralizing antibody. Therefore, these data suggested that DMSO promotes wound healing at least partially in an indirect manner involving fibroblast‐derived TGF‐β1‐mediated keratinocyte migration. Moreover, in addition to TGF‐β1, EGF, insulin‐like growth factor 1 (IGF‐1) and CXCL10 also play an important role in the re‐epithelialization process during wound healing (Haase, Evans, Pofahl, & Watt, 2003; Kroeze et al., 2012). Our results indicated that low concentrations of DMSO could indirectly promote keratinocyte migration by inducing the secretory expression of CXCL10 in fibroblasts.

In addition, DMSO is often used as a drug vehicle in medical experiments in vivo and in vitro. However, recent studies have demonstrated that DMSO also has some pharmacological effects, so bias can occur if control groups are not properly set, an effect of DMSO can be falsely attributed to the drug (Kelava, Cavar, & Culo, 2010). In this study, low‐concentration DMSO significantly activated the Akt/mTOR signalling pathway. The Akt/mTOR signalling pathway plays an important role in the occurrence and progression of multiple pathological conditions, including tumours, diabetes, ageing and Parkinson's disease (Lan, Chen, Zhao, Chai, & Hu, 2017; Saxton & Sabatini, 2017) and drugs for these conditions often target this pathway. Therefore, relevant studies must be carefully designed if DMSO is to be used as a drug vehicle and alternative vehicles may be required considering the pleiotropic effects of DMSO.

It is not clear how DMSO activates the Akt/mTOR pathway, but a recent study revealed that DMSO, at concentrations similar to those used in our study, significantly inhibits AChE (Kumar & Darreh‐Shori, 2017), whose substrate ACh activates mTOR via cell surface receptors, at least in neurons (Giovannini, Lana, & Pepeu, 2015; Zhao et al., 2013). It is not clear why a high concentration of DMSO inhibited cell growth and wound healing. We speculated that high concentrations of DMSO may excessively alter cell membrane permeability, which may have adverse effects (Xiang et al., 2018). Notably, the translation of only a set of genes, but not others, was activated after Akt/mTOR activation. These questions need to be answered in future studies.

In summary, DMSO promotes the healing of refractory diabetic wounds by activating the Akt/mTORC1 signalling pathway, leading to enhanced cap‐dependent translation of proliferation‐related genes, accelerated fibroblast proliferation and keratinocyte migration and increased extracellular matrix secretion, ultimately promoting diabetic wound healing (Figure 7). Thus, our findings provide a theoretical basis for the further development of DMSO as a pro‐healing drug for refractory wounds and highlight the regulatory role of Akt/mTOR signalling in the healing of refractory diabetic wounds. These results also warrant caution when using DMSO as a solvent in future pharmacological studies.

FIGURE 7.

FIGURE 7

Open in a new tab

Schematic of the pharmacological mechanism of DMSO. DMSO has a profound effect on fibroblast proliferation via Akt/mTOR‐mediated protein translation, which activates both collagen production and TGF‐β1 secretion. The active fibroblast TGF‐β1 induces EMT signalling in keratinocytes, promoting EMT‐like transdifferentiation and keratinocyte migration. EMT, epithelial–mesenchymal transition

AUTHOR CONTRIBUTIONS

X. X. and W. X. designed the study and revised the manuscript. W. G., W. Q., W. L., X. A., X. H. and L. A. performed experiments. W. G., W. Q., W. L., X.‐t. H., Z. L., M. Z. and D. L. analysed the data. W. G., W. Q. and W. L. wrote the manuscript. W. G., W. Q. and X. A. contributed equally to this work.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for Design & Analysis, Immunoblotting and Immunochemistry and Animal Experimentation and as recommended by funding agencies, publishers and other organisations engaged with supporting research.

Supporting information

Data S1. Supporting Information

Click here for additional data file. (16.2KB, docx)

Figure S1. DMSO treatment showed no effect on keratinocyte proliferation and fibroblast migration in vitro. (A) Mouse primary keratinocytes were treated with DMSO at a given concentration (1 mM, 5 mM or 20 mM) and cell proliferation was determined by a cell counting kit‐8 assay. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal‐Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. NS, not significant. (B) Scratch wound healing assay of mouse primary fibroblasts treated with 5 mM DMSO or vehicle control. (C) Fibroblast migration detection in vitro by transwell assays after treatment with 5 mM DMSO for 24 h. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t‐test. Significance level: NS, not significant, 5 mM DMSO vs the control group.

Click here for additional data file. (417.8KB, JPG)

Figure S2. The effect of DMSO treatment on diabetic skin wound healing and fibroblast proliferation with a finer series of DMSO concentration. (A) Percentage of wound closure in each group, calculated as (A0 – Ai)/A0 × 100% (A0: area of wound on day 0; Ai: area of wound on day i). Data are presented as the mean ± SEM with n = 12 for all groups, analysed by one‐way ANOVA with Kruskal‐Wallis test for multiple comparison. Significance level: *P < 0.05, 5 mM DMSO vs the control group. (B) The effect of DMSO treatment on DMFs proliferation by cell counting kit‐8 assays. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal‐Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. (C) DMSO (5 mM) treatment promoted diabetic and normal wound healing. Data are presented as the mean ± SEM with n = 12 for all groups, analysed by Student's t‐test. Significance level: *P < 0.05, DMSO vs the control group in non‐diabetic mice; # P < 0.05, DMSO vs the control group in diabetic mice.

Click here for additional data file. (426.9KB, jpg)

Figure S3. Active eIF4F was measured by 7mGTP pull‐down assays in the diabetic mice wound tissue. (A). The detection of eIF4G, eIF4E and 4EBP‐1 in the eIF4F complex using 7mGTP pull‐down assays in the wound tissue 13 days after injury (n = 6). (B).Pull‐down efficiency presents the integrated optical density values of protein bands. The IOD of the protein band was calibrated with input; Data are presented as the mean ± SEM with n = 6 for all groups, analysed by Student's t‐test. Significance level: *P < 0.05, 5 mM DMSO vs the control group. NS, not significant.

Click here for additional data file. (230.3KB, jpg)

Figure S4. The effect of DMSO on the secretion of EGF, CXCL10 and IGF‐1 in fibroblasts and keratinocytes. (A) A total of 1 × 105 fibroblasts or (B) 1 × 105 keratinocytes were cultured in 24 well plates overnight and treated with 5 mM DMSO for another 24 h. EGF, CXCL10 and IGF‐1 in the medium were detected by ELISA kits. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t‐test. Significance level: *P < 0.05, 5 mM DMSO vs the control group. NS, not significant.

Click here for additional data file. (317.2KB, JPG)

Table S1. List of primers.

Click here for additional data file. (19KB, docx)

Table S2. Primary antibodies used for western blotting

Click here for additional data file. (15.6KB, docx)

ACKNOWLEDGEMENTS

We thank Jian Yu, Department of Pathology, University of Pittsburgh School of Medicine, for helpful discussion and critical review throughout the course of this study. This study was supported by the National Natural Science Foundation of China (NSFC, 81571913 and 81871568), the Chongqing Natural Science Foundation (cstc2015jcyjA10078) and Military pre‐research program of the Army Medical University (2019XYY21).

Guo W, Qiu W, Ao X, et al. Low‐concentration DMSO accelerates skin wound healing by Akt/mTOR‐mediated cell proliferation and migration in diabetic mice. Br J Pharmacol. 2020;177:3327–3341. 10.1111/bph.15052

Contributor Information

Wei Xing, Email: wxingchina@sina.com.

Xiang Xu, Email: xiangxu@tmmu.edu.cn.

REFERENCES

  1. Alberts, D. S. , & Dorr, R. T. (1991). Case report: Topical DMSO for mitomycin‐C‐induced skin ulceration. Oncology Nursing Forum, 18, 693–695. [PubMed] [Google Scholar]
  2. Alexander, S. P. H. , Fabbro, D. , Kelly, E. , Mathie, A. , Peters, J. A. , Veale, E. L. , … CGTP Collaborators . (2019). The concise guide to pharmacology 2019/20: Enzymes. British Journal of Pharmacology, 176(S1), S297–S396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Asrani, K. , Sood, A. , Torres, A. , Georgess, D. , Phatak, P. , Kaur, H. , … Lotan, T. L. (2017). MTORC1 loss impairs epidermal adhesion via TGF‐β/Rho kinase activation. The Journal of Clinical Investigation, 127, 4001–4017. 10.1172/JCI92893 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cheng, F. , Shen, Y. , Mohanasundaram, P. , Lindstrom, M. , Ivaska, J. , Ny, T. , & Eriksson, J. E. (2016). Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via TGF‐β–Slug signaling. Proceedings of the National Academy of Sciences of the United States of America, 113, E4320–E4327. 10.1073/pnas.1519197113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Curtis, M. J. , Bond, R. A. , Spina, D. , Ahluwalia, A. , Alexander, S. P. , Giembycz, M. A. , et al. (2018). Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers. British Journal of Pharmacology, 175, 987–993. 10.1111/bph.14153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Elisia, I. , Nakamura, H. , Lam, V. , Hofs, E. , Cederberg, R. , Cait, J. , … Krystal, G. (2016). DMSO represses inflammatory cytokine production from human blood cells and reduces autoimmune arthritis. PLoS ONE, 11, e152538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Giovannini, M. G. , Lana, D. , & Pepeu, G. (2015). The integrated role of ACh, ERK and mTOR in the mechanisms of hippocampal inhibitory avoidance memory. Neurobiology of Learning and Memory, 119, 18–33. [DOI] [PubMed] [Google Scholar]
  8. Godel, M. , Hartleben, B. , Herbach, N. , Liu, S. , Zschiedrich, S. , Lu, S. , … Huber, T. B. (2011). Role of mTOR in podocyte function and diabetic nephropathy in humans and mice. The Journal of Clinical Investigation, 121, 2197–2209. 10.1172/JCI44774 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Goldblum, O. M. , Alvarez, O. M. , Mertz, P. M. , & Eaglstein, W. H. (1983). Dimethyl sulfoxide (DMSO) does not affect epidermal wound healing. Proceedings of the Society for Experimental Biology and Medicine, 172, 301–307. [DOI] [PubMed] [Google Scholar]
  10. Goren, I. , Muller, E. , Schiefelbein, D. , Gutwein, P. , Seitz, O. , Pfeilschifter, J. , & Frank, S. (2009). Akt1 controls insulin‐driven VEGF biosynthesis from keratinocytes: Implications for normal and diabetes‐impaired skin repair in mice. The Journal of Investigative Dermatology, 129, 752–764. 10.1038/jid.2008.230 [DOI] [PubMed] [Google Scholar]
  11. Haase, I. , Evans, R. , Pofahl, R. , & Watt, F. M. (2003). Regulation of keratinocyte shape, migration and wound epithelialization by IGF‐1‐ and EGF‐dependent signalling pathways. Journal of Cell Science, 116, 3227–3238. [DOI] [PubMed] [Google Scholar]
  12. Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR . (2018). The IUPHAR/BPS guide to pharmacology in 2018: Updates and expansion to encompass the new guide to immunopharmacology. Nucleic Acids Research, 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hollebeeck, S. , Raas, T. , Piront, N. , Schneider, Y. J. , Toussaint, O. , Larondelle, Y. , & During, A. (2011). Dimethyl sulfoxide (DMSO) attenuates the inflammatory response in the in vitro intestinal Caco‐2 cell model. Toxicology Letters, 206, 268–275. 10.1016/j.toxlet.2011.08.010 [DOI] [PubMed] [Google Scholar]
  14. Huang, H. , Cui, W. , Qiu, W. , Zhu, M. , Zhao, R. , Zeng, D. , … Xu, X. (2015). Impaired wound healing results from the dysfunction of the Akt/mTOR pathway in diabetic rats. Journal of Dermatological Science, 79, 241–251. 10.1016/j.jdermsci.2015.06.002 [DOI] [PubMed] [Google Scholar]
  15. Huu, N. , & Albert, H. M. (1966). Effect of DMSO on wound healing: Tensile strength measurements in rabbits. The American Surgeon, 32, 421–424. [PubMed] [Google Scholar]
  16. Inoki, K. , Mori, H. , Wang, J. , Suzuki, T. , Hong, S. , Yoshida, S. , … Guan, K. L. (2011). MTORC1 activation in podocytes is a critical step in the development of diabetic nephropathy in mice. The Journal of Clinical Investigation, 121, 2181–2196. 10.1172/JCI44771 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kaur, A. , & Sharma, S. (2017). Mammalian target of rapamycin (mTOR) as a potential therapeutic target in various diseases. Inflammopharmacology, 25, 293–312. [DOI] [PubMed] [Google Scholar]
  18. Kelava, T. , Cavar, I. , & Culo, F. (2010). Influence of small doses of various drug vehicles on acetaminophen‐induced liver injury. Canadian Journal of Physiology and Pharmacology, 88, 960–967. [DOI] [PubMed] [Google Scholar]
  19. Kiritsi, D. , & Nystrom, A. (2018). The role of TGFβ in wound healing pathologies. Mechanisms of Ageing and Development, 172, 51–58. [DOI] [PubMed] [Google Scholar]
  20. Korsheninnikova, E. , van der Zon, G. C. , Voshol, P. J. , Janssen, G. M. , Havekes, L. M. , Grefhorst, A. , … Maassen, J. A. (2006). Sustained activation of the mammalian target of rapamycin nutrient sensing pathway is associated with hepatic insulin resistance, but not with steatosis, in mice. Diabetologia, 49, 3049–3057. 10.1007/s00125-006-0439-5 [DOI] [PubMed] [Google Scholar]
  21. Kroeze, K. L. , Boink, M. A. , Sampat‐Sardjoepersad, S. C. , Waaijman, T. , Scheper, R. J. , & Gibbs, S. (2012). Autocrine regulation of re‐epithelialization after wounding by chemokine receptors CCR1, CCR10, CXCR1, CXCR2, and CXCR3. The Journal of Investigative Dermatology, 132, 216–225. [DOI] [PubMed] [Google Scholar]
  22. Kumar, A. , & Darreh‐Shori, T. (2017). DMSO: A mixed‐competitive inhibitor of human acetylcholinesterase. ACS Chemical Neuroscience, 8, 2618–2625. [DOI] [PubMed] [Google Scholar]
  23. Lan, A. P. , Chen, J. , Zhao, Y. , Chai, Z. , & Hu, Y. (2017). MTOR signaling in Parkinson's disease. Neuromolecular Medicine, 19, 1–10. [DOI] [PubMed] [Google Scholar]
  24. Laplante, M. , & Sabatini, D. M. (2012). MTOR signaling in growth control and disease. Cell, 149, 274–293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lebredo, L. , Barrie, R. , & Woltering, E. A. (1992). DMSO protects against adriamycin‐induced tissue necrosis. The Journal of Surgical Research, 53, 62–65. [DOI] [PubMed] [Google Scholar]
  26. Li, F. , Adase, C. A. , & Zhang, L. J. (2017). Isolation and culture of primary mouse keratinocytes from neonatal and adult mouse skin. Journal of Visualized Experiments. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lim, J. Z. , Ng, N. S. , & Thomas, C. (2017). Prevention and treatment of diabetic foot ulcers. Journal of the Royal Society of Medicine, 110, 104–109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu, R. , Hossain, M. M. , Chen, X. , & Jin, J. P. (2017). Mechanoregulation of SM22α/Transgelin. Biochemistry, 56, 5526–5538. [DOI] [PubMed] [Google Scholar]
  29. McGrath, J. C. , & Lilley, E. (2015). Implementing guidelines on reporting research using animals (ARRIVE etc.): New requirements for publication in BJP. British Journal of Pharmacology, 172, 3189–3193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. NCD Risk Factor Collaboration . (2016). Worldwide trends in diabetes since 1980: A pooled analysis of 751 population‐based studies with 4.4 million participants. Lancet, 387, 1513–1530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ogurtsova, K. , da Rocha Fernandes, J. D. , Huang, Y. , Linnenkamp, U. , Guariguata, L. , Cho, N. H. , … Makaroff, L. E. (2017). IDF diabetes atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Research and Clinical Practice, 128, 40–50. 10.1016/j.diabres.2017.03.024 [DOI] [PubMed] [Google Scholar]
  32. Qing, C. (2017). The molecular biology in wound healing & non‐healing wound. Chinese Journal of Traumatology, 20, 189–193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Raposio, E. , & Santi, P. L. (1999). Topical application of DMSO as an adjunct to tissue expansion for breast reconstruction. British Journal of Plastic Surgery, 52, 194–197. [DOI] [PubMed] [Google Scholar]
  34. Russo, M. A. , & Santarelli, D. M. (2016). A novel compound analgesic cream (ketamine, pentoxifylline, clonidine, DMSO) for complex regional pain syndrome patients. Pain Practice, 16, E14–E20. [DOI] [PubMed] [Google Scholar]
  35. Sarbassov, D. D. , Ali, S. M. , Sengupta, S. , Sheen, J. H. , Hsu, P. P. , Bagley, A. F. , … Sabatini, D. M. (2006). Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Molecular Cell, 22, 159–168. 10.1016/j.molcel.2006.03.029 [DOI] [PubMed] [Google Scholar]
  36. Saxton, R. A. , & Sabatini, D. M. (2017). MTOR signaling in growth, metabolism, and disease. Cell, 169, 361–371. [DOI] [PubMed] [Google Scholar]
  37. Singh, N. , Armstrong, D. G. , & Lipsky, B. A. (2005). Preventing foot ulcers in patients with diabetes. JAMA, 293, 217–228. [DOI] [PubMed] [Google Scholar]
  38. Situm, M. , Kolic, M. , Redzepi, G. , & Antolic, S. (2014). Chronic wounds as a public health problem. Acta Medica Croatica, 68(Suppl 1), 5–7. [PubMed] [Google Scholar]
  39. Squarize, C. H. , Castilho, R. M. , Bugge, T. H. , & Gutkind, J. S. (2010). Accelerated wound healing by mTOR activation in genetically defined mouse models. PLoS ONE, 5, e10643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Truitt, M. L. , Conn, C. S. , Shi, Z. , Pang, X. , Tokuyasu, T. , Coady, A. M. , … Ruggero, D. (2015). Differential requirements for eIF4E dose in normal development and cancer. Cell, 162, 59–71. 10.1016/j.cell.2015.05.049 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Volkers, M. , Doroudgar, S. , Nguyen, N. , Konstandin, M. H. , Quijada, P. , Din, S. , … Sussman, M. A. (2014). PRAS40 prevents development of diabetic cardiomyopathy and improves hepatic insulin sensitivity in obesity. EMBO Molecular Medicine, 6, 57–65. 10.1002/emmm.201303183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Whiting, D. R. , Guariguata, L. , Weil, C. , & Shaw, J. (2011). IDF diabetes atlas: Global estimates of the prevalence of diabetes for 2011 and 2030. Diabetes Research and Clinical Practice, 94, 311–321. [DOI] [PubMed] [Google Scholar]
  43. World Health Organization . (2016). Global report on diabetes. Working Papers.
  44. Xiang, Y. , Zhao, M. M. , Sun, S. , Guo, X. L. , Wang, Q. , Li, S. A. , … Zhang, Y. (2018). A high concentration of DMSO activates caspase‐1 by increasing the cell membrane permeability of potassium. Cytotechnology, 70, 313–320. 10.1007/s10616-017-0145-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Xu, X. , Vatsyayan, J. , Gao, C. , Bakkenist, C. J. , & Hu, J. (2010). HDAC2 promotes eIF4E sumoylation and activates mRNA translation gene specifically. The Journal of Biological Chemistry, 285, 18139–18143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhao, F. , Lang, H. , Wang, Z. , Zhang, T. , Zhang, D. , Wang, R. , … Pang, X. (2019). Human novel MicroRNA seq‐915_x4024 in keratinocytes contributes to skin regeneration by suppressing scar formation. Mol Ther Nucleic Acids, 14, 410–423. 10.1016/j.omtn.2018.12.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhao, M. , Sun, L. , Yu, X. J. , Miao, Y. , Liu, J. J. , Wang, H. , … Zang, W. J. (2013). Acetylcholine mediates AMPK‐dependent autophagic cytoprotection in H9c2 cells during hypoxia/reoxygenation injury. Cellular Physiology and Biochemistry, 32, 601–613. 10.1159/000354464 [DOI] [PubMed] [Google Scholar]
  48. Zhao, P. , Sui, B. D. , Liu, N. , Lv, Y. J. , Zheng, C. X. , Lu, Y. B. , … Jin, Y. (2017). Anti‐aging pharmacology in cutaneous wound healing: Effects of metformin, resveratrol, and rapamycin by local application. Aging Cell, 16, 1083–1093. 10.1111/acel.12635 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1. Supporting Information

Click here for additional data file. (16.2KB, docx)

Figure S1. DMSO treatment showed no effect on keratinocyte proliferation and fibroblast migration in vitro. (A) Mouse primary keratinocytes were treated with DMSO at a given concentration (1 mM, 5 mM or 20 mM) and cell proliferation was determined by a cell counting kit‐8 assay. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal‐Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. NS, not significant. (B) Scratch wound healing assay of mouse primary fibroblasts treated with 5 mM DMSO or vehicle control. (C) Fibroblast migration detection in vitro by transwell assays after treatment with 5 mM DMSO for 24 h. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t‐test. Significance level: NS, not significant, 5 mM DMSO vs the control group.

Click here for additional data file. (417.8KB, JPG)

Figure S2. The effect of DMSO treatment on diabetic skin wound healing and fibroblast proliferation with a finer series of DMSO concentration. (A) Percentage of wound closure in each group, calculated as (A0 – Ai)/A0 × 100% (A0: area of wound on day 0; Ai: area of wound on day i). Data are presented as the mean ± SEM with n = 12 for all groups, analysed by one‐way ANOVA with Kruskal‐Wallis test for multiple comparison. Significance level: *P < 0.05, 5 mM DMSO vs the control group. (B) The effect of DMSO treatment on DMFs proliferation by cell counting kit‐8 assays. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by one‐way ANOVA with Kruskal‐Wallis test for multiple comparison. Significance level: *P < 0.05, compared with the control group. (C) DMSO (5 mM) treatment promoted diabetic and normal wound healing. Data are presented as the mean ± SEM with n = 12 for all groups, analysed by Student's t‐test. Significance level: *P < 0.05, DMSO vs the control group in non‐diabetic mice; # P < 0.05, DMSO vs the control group in diabetic mice.

Click here for additional data file. (426.9KB, jpg)

Figure S3. Active eIF4F was measured by 7mGTP pull‐down assays in the diabetic mice wound tissue. (A). The detection of eIF4G, eIF4E and 4EBP‐1 in the eIF4F complex using 7mGTP pull‐down assays in the wound tissue 13 days after injury (n = 6). (B).Pull‐down efficiency presents the integrated optical density values of protein bands. The IOD of the protein band was calibrated with input; Data are presented as the mean ± SEM with n = 6 for all groups, analysed by Student's t‐test. Significance level: *P < 0.05, 5 mM DMSO vs the control group. NS, not significant.

Click here for additional data file. (230.3KB, jpg)

Figure S4. The effect of DMSO on the secretion of EGF, CXCL10 and IGF‐1 in fibroblasts and keratinocytes. (A) A total of 1 × 105 fibroblasts or (B) 1 × 105 keratinocytes were cultured in 24 well plates overnight and treated with 5 mM DMSO for another 24 h. EGF, CXCL10 and IGF‐1 in the medium were detected by ELISA kits. Data are presented as the mean ± SEM with n = 5 for all groups, analysed by Student's t‐test. Significance level: *P < 0.05, 5 mM DMSO vs the control group. NS, not significant.

Click here for additional data file. (317.2KB, JPG)

Table S1. List of primers.

Click here for additional data file. (19KB, docx)

Table S2. Primary antibodies used for western blotting

Click here for additional data file. (15.6KB, docx)

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES