Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2020 Apr 18;177(14):3342–3356. doi: 10.1111/bph.15058

Neuroprotection induced by dexpramipexole delays disease progression in a mouse model of progressive multiple sclerosis

Daniela Buonvicino 1,✉, Giuseppe Ranieri 1, Sara Pratesi 2, Elisabetta Gerace 3, Mirko Muzzi 1, Daniele Guasti 4, Lorenzo Tofani 5, Alberto Chiarugi 1
PMCID: PMC7312322  PMID: 32199028

Abstract

Background and Purpose

Drugs able to counteract progressive multiple sclerosis (MS) represent a largely unmet therapeutic need. Even though the pathogenesis of disease evolution is still obscure, accumulating evidence indicates that mitochondrial dysfunction plays a causative role in neurodegeneration and axonopathy in progressive MS patients. Here, we investigated the effects of dexpramipexole, a compound with a good safety profile in humans and able to sustain mitochondria functioning and energy production, in a mouse model of progressive MS.

Experimental Approach

Female non‐obese diabetic mice were immunized with MOG35–55. Functional, immune and neuropathological parameters were analysed during disease evolution in animals treated or not with dexpramipexole. The compound's effects on bioenergetics and neuroprotection were also evaluated in vitro.

Key Results

We found that oral treatment with dexpramipexole at a dose consistent with that well tolerated in humans delayed disability progression, extended survival, counteracted reduction of spinal cord mitochondrial DNA content and reduced spinal cord axonal loss of mice. Accordingly, the drug sustained in vitro bioenergetics of mouse optic nerve and dorsal root ganglia and counteracted neurodegeneration of organotypic mouse cortical cultures exposed to the adenosine triphosphate‐depleting agents oligomycin or veratridine. Dexpramipexole, however, was unable to affect the adaptive and innate immune responses both in vivo and in vitro.

Conclusion and Implication

The present findings corroborate the hypothesis that neuroprotective agents may be of relevance to counteract MS progression and disclose the translational potential of dexpramipexole to treatment of progressive MS patients as a stand‐alone or adjunctive therapy.

Abbreviations

FCCP

carbonyl cyanide 4‐(trifluoromethoxy)phenylhydrazone

IONO

ionomycin

MOG

myelin oligodendrocyte glycoprotein

mt

mitochondrial

NOD

non‐obese diabetic

OVA

ovalbumin

PEAE

progressive experimental autoimmune encephalomyelitis

PMA

phorbol 12‐myristate 13‐acetate

What is already known

  • Mitochondrial dysfunction contributes to neurodegeneration and axonopathy in patients with progressive MS.

  • Dexpramipexole ameliorates mitochondrial function by increasing ATP production.

What this study adds

  • We found that dexpramipexole reduced disease progression and mortality in a mouse model of progressive MS.

What is the clinical significance

  • Given its safety profile in humans, dexpramipexole has a translational potential to treatment of progressive MS.

1. INTRODUCTION

In spite of the high need for drugs able to counteract progression of multiple sclerosis (MS), the pathogenetic mechanisms responsible for MS evolution is still waiting to be understood. Several lines of evidence indicate that neurodegeneration during progressive MS (PMS) is prompted by a state of virtual hypoxia within demyelinated axons that, in turn, triggers bioenergetic derangement and retrograde neuronal death (Sedel, Bernard, Mock, & Tourbah, 2016; Trapp & Stys, 2009). In light of this, it has been hypothesized that supporting energy dynamics and mitochondrial functioning in particular, with drugs able to support organelle efficiency within the CNS of progressive MS patients may represent a valid strategy to counteract disease progression (Armstrong, 2009; Campbell, Licht‐Mayer, & Mahad, 2019).

Recently, we characterized the non‐obese diabetic (NOD) mouse model of progressive MS from a neuro‐ and an immunopathological perspective (Buonvicino, Ranieri, Pratesi, Guasti, & Chiarugi, 2019). By following the disease evolution in these mice for the entire duration of its progression (about 6 months), we have been able to define the therapeutic effects of bioenergetics‐boosting drugs such as bezafibrate (Liang & Ward, 2006) or biotin (Ochoa‐Ruiz et al., 2015) and as such may have an intrinsic translational potential for the treatment of progressive MS patients. Remarkably, we have been unable to find any effect with drugs on the severity and the evolution of progressive experimental autoimmune encephalomyelitis (PEAE) in NOD mice (Buonvicino et al., 2019). These findings, along with evidence that compounds targeting autoimmunity, such as ocrelizumab (Montalban et al., 2017) or siponimod (Kappos et al., 2018), have been shown to efficacious in progressive MS patients, leaves an unaddressed the question as to whether pharmacological support of neuronal bioenergetics is of therapeutic relevance to MS progression.

In an attempt to answer this question, instead of using compounds with a broad activity on bioenergetics metabolism, we focused our attention on compounds that are able to specifically target mitochondria and in particular their energy producing efficacy. Thus, by maintaining a bedside to bench approach that can circumvent drug attrition and accelerate clinical translation to progressive MS patients, we selected dexpramipexole, the R‐enantiomer of the anti‐parkinsonian drug pramipexole, which shows clinically little ability to bind to dopamine receptors (Gribkoff & Bozik, 2008). Remarkably, experimental evidence indicates that dexpramipexole improves mitochondrial efficiency by increasing ATP production in spite of reduced oxygen consumption (Alavian et al., 2012; Muzzi et al., 2018), a key effect that, in principle, might counteract virtual hypoxia in degenerating axons during progressive MS. In keeping with this interpretation, further studies have demonstrated the ability of dexpramipexole to bind specific subunits of F1Fo–ATP synthase and prevent mitochondrial swelling and permeability transition (Alavian et al., 2015; Cassarino, Fall, Smith, & Bennett, 1998; Sayeed et al., 2006). This further supports a possible therapeutic effect of dexpramipexole in a demyelinating environment which leads to neuronal and axonal virtual hypoxia. We have recently reported that dexpramipexole increases ATP production in primary cultures of neuronal or glial cells, counteracts anoxic depolarization of brain tissue and protects the rodent brain form both transient and permanent hypoxia/ischaemia (Muzzi, Buonvicino, Urru, Tofani, & Chiarugi, 2018, Muzzi, Gerace, et al., 2018). In addition, dexpramipexole has been recently tested in a large Phase III trial in ALS patients with the aim of supporting survival of motor neurons, however these neurones do not appear to undergo degeneration because of a hypoxic–ischaemic insult. Consistent with this interpretation, the study did not reach its endpoints, even though the compound showed excellent tolerability and safety profiles in hundreds of patients exposed to daily doses of the drug over several month (Cudkowicz et al., 2013). Dexpramipexole has also been recently evaluated for the treatment of patients affected by hyper‐eosinophilic syndromes and these studies have confirmed its favourable safety profile (Dworetzky et al., 2017; Panch et al., 2018).

In the present study, we have reported the effects of dexpramipexole in the progressive experimental autoimmune encephalomyelitis NOD mouse model, focusing on the drug's impact on disease evolution, as well as on neuro‐ and immunopathological events.

2. METHODS

2.1. Animals

Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010) and with the recommendations made by the British Journal of Pharmacology and all animal care and experimental procedures were performed according to the European Community guidelines for animal care (European Communities Council Directive 2010/63/EU) and were approved by the Committee for Animal Care and Experimental Use of the University of Florence. Given the well‐known 3:1 female : male ratio in MS patients, experimental autoimmune encephalomyelitis (EAE) is typically induced in female animals, and indeed, only female mice were used in our study. Female NOD/ShiLtj (IMSR Cat# JAX:001976, RRID:IMSR_JAX:001976) and C57BL/6 mice (IMSR Cat# CRL:642, RRID:IMSR_CRL:642) (Charles River, Milan, Italy) were housed in a conventional unit (five to six per cage) with free access to food (Harlan Global Diet 2018, Harlan Laboratories, Udine, Italy) and water, and maintained on a 12 h light/dark cycle at 21°C room temperature.

2.2. Myelin oligodendrocyte glycoprotein (MOG)35–55 immunization and neuroscore evaluation

Experimental autoimmune encephalomyelitis was induced in 10‐week‐old NOD/ShiLtj mice with MOG35–55 peptide (MEVGWYRSPFSRVVHLYRNGK) (synthesized by EspiKem Srl., University of Florence, Italy) (Buonvicino et al., 2019), which were then randomized (generating two groups by the RAND function of Microsoft Excel software, RRID:SCR_016137) and treated with dexpramipexole or vehicle as follows. Dexpramipexole (Sigma, Milan, Italy) was dissolved in PBS and administrated p.o. on a daily basis at 10 mg·kg−1 body weight. Treatments started at 20 days post immunization, unless otherwise specified in the text. Immunized vehicle‐treated animals daily received the same amount of PBS. Clinical signs of experimental autoimmune encephalomyelitis were examined daily by blinded operators as reported (Buonvicino et al., 2019). The following score were assigned: 0, normal; 0.25 or 0.5, splay reflex test (performed by lifting the mouse by its tail and observing the degree of hindlimb splay during 10 s. If both hindlimbs were splayed outward away from the abdomen, a 0 score was assigned. If one or both hindlimbs were partially retracted toward the abdomen without touching it, a score 0.25 or 0.5 was assigned, respectively:‐ 1, weakness of the tail/hind limbs; 2, ataxia and/or difficulty in righting; 3, paralysis of the hind limbs and/or paresis of the forelimbs and 4, tetraplegia. When mice reached a score of 2, food and water were positioned on the floor of the cage for easy access. Because of ethical reasons, mice were killed as soon as they reached the score of 4. Two experiments with eight mice per group were conducted. Group size was obtained with effect size d = 1.4 (Rothhammer et al., 2017), α error prob = 0.05 and power = 0.8 by G*Power Version 3.0.10 (G*Power, RRID:SCR_013726) (Franz Faul, University of Kiel, Germany). One control animal was killed during the first experiment because of infection in the site of immunization, whereas a mouse in the dexpramipexole group was found dead on Day 2 after immunization during the second experiment. Thus, the total number of mice per group for neuroscore, disease duration and disability progression was n = 15 (vehicle) and n = 15 (dexpramipexole).

2.3. Ovalbumin immunization

Ovalbumin immunization was induced in 7‐ to 8‐week‐old C57BL/6 mice with 200 μg of chicken egg albumin (Type IV, Sigma, Milan, Italy) as reported (Cavone, Peruzzi, Caporale, & Chiarugi, 2014). After immunization, animals were randomized (as reported above) and treated with dexpramipexole (10 mg·kg−1 per p.o, daily) or vehicle, for 2 weeks from the day of immunization.

2.4. Histological analysis

Histological analysis has been performed in 24 mice that were immunized and randomized into two groups (70 and 140 days post immunization) by the RAND function of Excel software. Each group was again randomized to identify vehicle‐ and dexpramipexole‐treated mice. Each group was therefore of six mice. Lumbosacral spinal cords were collected from control or 70 and 140 post immunization MOG‐immunized NOD mice, fixed in 4% paraformaldehyde in 0.1‐M PBS, embedded in paraffin and cut into 10‐μm thin sections. Axonal loss and myelin loss were assessed by Bielschowsky's silver staining and Luxol Fast Blue, respectively. For each spinal cord, serial sections of the lumbosacral portion have been collected at a 1‐mm interval and distributed on to slides for a total of six sections per slide. Images were acquired by using an Olympus BX40 microscope (Olympus, Milan, Italy) and a digital camera (Olympus DP50) with NIS‐Elements software (NIS‐Elements, RRID:SCR_014329); sections were analysed by a blinded operator by using ImageJ software (ImageJ, RRID:SCR_003070) (Buonvicino et al., 2019).

2.5. Flow cytometry

The spleen and spinal cord infiltrating leukocytes were characterized by flow cytometry. Briefly, MOG‐immunized NOD mice were killed at different time points and perfused with cold saline prior to organ collection. Then a single cell suspension for each sample was prepared and stained with anti‐CD4 FITC (Miltenyi Biotec Cat# 130‐120‐750, RRID:AB_2752185), anti‐CD8 PE (Miltenyi Biotec Cat# 130‐123‐781, RRID:AB_2811550), anti‐C45R (B220) APC (Miltenyi Biotec Cat# 130‐110‐847, RRID:AB_2658277), and anti‐NKp46 PerCP‐Vio770 (Miltenyi Biotec Cat# 130‐112‐362, RRID:AB_2657614) or isotype‐matched control IgG antibodies, according to the manufacturer's instructions (Cavone et al., 2014, 2015). The cells were then analysed using a FACSCanto II flow cytometer (BD Scientific Canto II Flow Cytometer, RRID:SCR_018056) equipped with FACSDiva software (BD FACSDiva Software, RRID:SCR_001456), acquiring a total of 105 events for each spleen and spinal cord extract.

2.6. Lymphocyte proliferation

Cells extracted from lymph nodes of control, MOG35–55‐ or ovalbumin‐immunized mice treated or not for 15 days with dexpramipexole (10 mg·kg−1 per os, daily) were cultured in complete RPMI (Life Technologies, Monza, Italy) in 96 wells plates (2 × 105 cells per well) and re‐challenged or not with MOG35–55 (20 μg·ml−1) or ovalbumin (20 μg·ml−1). After 72 h, the proliferative response was measured by [3H]thymidine (Perkin Elmer, Milan, Italy) incorporation as reported (Cavone et al., 2015). Similarly, cells extracted from the spleen of score four NOD mice were incubated with dexamethasone or dexpramipexole (Sigma Aldrich, Milan, Italy) re‐challenged with MOG35–55 (20 μg·ml−1) and then proliferative response evaluated, or exposed to 50 ng·ml−1 phorbol myristate acetate (PMA) plus 1 μg·ml−1 ionomycin (both Sigma, Milan, Italy) and RNA extracted for transcript analysis after 24 h.

2.7. Immunohistochemistry

For immunohistochemical analysis, lumbosacral spinal cords from control or MOG‐immunized NOD mice, treated or not with dexpramipexole from Day 20 to 140 post immunization, were collected; 10‐μm thin sections were blocked with 5% normal goat serum (Thermo Fisher Scientific, Waltham, MA, USA) containing 0.3% Triton X‐100 (Sigma, Milan, Italy). One hour later, sections were incubated overnight at 4°C with a rabbit polyclonal anti ionized calcium‐binding adapter molecule 1 (IBA1) (1:300, Wako Cat# 013‐26471, RRID:AB_2687911) for microglia, or with a mouse polyclonal antibodies against glial fibrillary acidic protein (GFAP) (1:500, Cell Signaling Technology Cat# 12389, RRID:AB_2631098). After washings, sections were incubated with an anti‐rabbit secondary antibody conjugated with AlexaFluor 546 (1:2000, (Thermo Fisher Scientific Cat# A‐11035, RRID:AB_2534093) or with an anti‐mouse secondary antibody Cy3‐conjugated (1:1,000, Jackson ImmunoResearch Labs Cat# 715‐165‐020, RRID:AB_2340811). Images were acquired under a LEICA TCS SP5 confocal laser scanning microscope (Leica Microsystems CMS GmbH, Mannheim, Germany) with a 4× and 20× objective. Quantification of astrocytes and microglia immunofluorescence was performed using ImageJ (RRID:SCR_003070). Values correspond to the mean of six different microscopic fields of five different mouse spinal cord sections.

2.8. Mouse microglia primary cultures

Primary mixed cultures of astrocytes and microglia were prepared from postnatal Day 1 NOD mice as previously described (Chiarugi & Moskowitz, 2003) and grown in DMEM plus 10% FBS. Pure microglial cultures (95% pure) were obtained by shaking mixed glial cell cultures to dislodge microglia. Cells were subcultured in 48‐well plates for 48 h before stimulation with 0.3 μg·ml−1 LPS (Sigma, Milan, Italy) in the presence or absence of dexpramipexole or dexamethasone (Sigma, Milan, Italy). After 48 h, supernatants were collected for cytokine measurements and RNA extracted for transcript analysis.

2.9. Dorsal root ganglia (DRG) explant

Dorsal root ganglia were cultured as described (Gilley & Coleman, 2010). Briefly, intact DRG were dissected from killed P8‐P10 Wistar rat pups (RGD Cat# 2308816, RRID:RGD_2308816) plated on 3.5‐cm dishes precoated with poly‐l‐lysine (20 μg·ml−1 for 2 h, Sigma, Milan, Italy) and laminin (20 μg·ml−1, Sigma, Milan, Italy) and cultured in DMEM medium (4.5 g·L−1 glucose) (Sigma, Milan, Italy) supplemented with 100 ng·ml−1 nerve grow factor (Sigma, Milan, Italy) and B27 supplement (Invitrogen, Milan, Italy). Cultures were used after 7–10 days in vitro, when axonal sprouting occurs.

2.10. Optic nerve preparation

After euthanasia, the eyes of 10‐week‐old NOD mice were enucleated using curved scissors and placed in cold PBS. The optic nerve was carefully cut from the back of the eye using microscissors and incubated in a low‐glucose DMEM (0.5 g·L−1 glucose) (Sigma, Milan, Italy) in the absence or presence of dexpramipexole. After 24 h, ATP content was evaluated.

2.11. Organotypic cortical slices preparation and assessment of neuronal injury

Organotypic cortical slice cultures were prepared in accordance with the methods described (Stoppini, Buchs, & Muller, 1991). Briefly, the parietal cortex was isolated from the brains of 8‐ to 9‐day‐old C57BL/6 mice pups (Harlan, Milan, Italy), and transverse slices (420 μm) were prepared using a McIlwain tissue chopper and then transferred on to 30 mm diameter semiporous membranes inserts (Millicell‐CM PICM03050; Millipore, Italy), which were placed in six well tissue culture plates containing 1.2‐ml medium per well. Slices were maintained at 37°C in an incubator in atmosphere of humidified air and 5% CO2 for 14 days. Slices were screened for viability and then exposed to oligomycin (100 nM) or veratridine (100 nM) (Sigma, Milan, Italy) in the absence or presence of dexpramipexole for 48 h. Cell death was assessed using the fluorescent dye PI (5 μg·ml−1) (Sigma, St Louis, MO, USA) as reported (Gerace et al., 2015). Images were acquired by a CCD camera (Diagnostic Instruments Inc., Sterling Heights, MI, USA) controlled by software (InCyt Im1TM; Intracellular Imaging Inc., Cincinnati, OH, USA) and subsequently analysed using the Image‐Pro Plus morphometric analysis software (Image‐Pro Plus, RRID:SCR_007369). In order to quantify cell death, the cortical subfield was identified and encompassed in a frame using the drawing function in the image software (ImageJ, RRID:SCR_003070), and the OD of PI fluorescence was detected.

2.12. Quantitative PCR

Total RNA was isolated from lymph node lymphocytes, microglia primary culture, and spinal cords of NOD‐immunized mice using Trizol Reagent (Life Technologies, Monza, Italy). One microgram of RNA was retrotranscribed using iScript (Bio‐Rad, Milan, Italy). RT‐PCR was performed as reported (Buonvicino et al., 2018). The following primers were used: INFγ: forward 5′‐ TCAGGCCATCAGCAACAACATAAGCG‐3′ and reverse 5′‐TTCCGCTTCCTGAGGCTGGATTCC‐3; IL13: forward 5′‐TAGAAGGGGCCGTGGCGAAACAG‐3′ and reverse 5′‐TCTGTGTAGCCCTGGATTCCCTGA‐3′; for IL10: forward 5′‐GGGTTGCCAAGCCTTATCGGAAATGA‐3′ and reverse 5′‐CACTCTTCACCTGCTCCACTGCC‐3′; IL1β: forward 5′‐GTGTCTTTCCCGTGGACCTTCC‐3′ and reverse 5′‐CAGCTCATATGGGTCCGACAGC‐3′; TNFα: forward 5′‐GTGGAACTGGCAGAAGAGGCACTC‐3′ and reverse 5′‐CTGGGCCATAGAACTGATGAGAGGG‐3′; IL6: forward 5′‐TTCCTCTCTGCAAGAGACTTCCATCC‐3′ and reverse 5′‐CTCTTTTCTCATTTCCACGATTTCCCAGAG‐3′; T‐bet: forward 5′‐TGCCTACCAGAACGCAGAGATCACTC‐3′ and reverse 5′‐GTAGAAACGGCTGGGAACAGGATACTG‐3′; RORγt: forward 5′‐CCATTCAGTATGTGGTGGAGTTTGCCAA‐3′ and reverse 5′‐GCAGCCCAAGGCTCGAAACAGCT‐3′; GATA3: forward 5′‐TGCCTGTGGGCTGTACTACAAGCTTCA‐3′ and reverse 5′‐GATGTGGCTCAGGGATGACATGTGTC‐3′; IL10: forward 5′‐GGGTTGCCAAGCCTTATCGGAAATGA‐3′ and reverse 5′‐CACTCTTCACCTGCTCCACTGCC‐3′; TGF‐β: forward 5′‐ATAGCAACAATTCCTGGCGTTACCTTGG‐3′ and reverse 5′‐GGCTGATCCCGTTGATTTCCACGTG‐3′; Foxp3: forward 5′‐CAAGCAGATCATCTCCTGGAT‐3′ and reverse 5′‐GTGGCTACGATGCAGCAAGAG‐3′; 18S: forward 5′‐AAAACCAACCCGGTGAGCTCCCTC‐3′ and reverse 5′‐CTCAGGCTCCCTCTCCGGAATCG‐3′. Genomic DNA was extracted from mice spinal cord with the NucleoSpin TriPrep kit (Macherey‐Nagel, Duren, Germany). Mitochondrial content was quantified by measuring the ratio between the mitochondrial Nd1 and nuclear β‐actin gene amplification products as reported (Felici et al., 2017). The following primers were used: mt‐Nd1 forward 5′‐TGCCAGCCTGACCCATAGCCATA‐3′ and reverse 5′‐ATTCTCCTTCTGTCAGGTCGAAGGG‐3′; β‐actin forward 5′‐GCAGCCACATTCCCGCGGTGTAG‐3′ and reverse 5′‐CCGGTTTGGACAAAGACCCAGAGG‐3′. Primers were purchased from Integrated DNA Technologies (Iowa, USA).

2.13. ELISA

Supernatants from microglia cultures exposed to LPS 0.3 μg·ml−1 were collected after 48 h for IL6, IL1β, and TNFα measurements by ELISA (all from Life Technologies, Monza, Italy) according to the manufacturer's instructions. Detection limits for IL6, IL1β and TNFα were 1.8, 4.8, and 7.21 pg·ml−1, respectively.

2.14. ATP measurement

Cellular ATP content was measured by means of an ATPlite kit (Perkin Elmer, Milan, Italy) as described (Buonvicino et al., 2018). Briefly, 100 μl of luciferase buffer was added to dorsal root ganglia or optic nerves cultured in a 48‐well plate and gently mixed, then 20 μl of d‐luciferin was added. Luminescence was evaluated within 1 min by means of a luminometer.

2.15. Statistical analysis

The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018). Data are expressed as mean ± SEM. In order to evaluate the difference in continuous parameters between the two groups, Mann–Whitney test (according to Kolmogorov–Smirnov test for normality and Bartlett's test for variance equality) is used. To test the difference in continuous parameters between more than two groups, Kruskal–Wallis and post hoc Dunn's test (according to Kolmogorov–Smirnov test for normality and Bartlett's test for variance equality) are used. The differences in overall survival and confirmed disease progression between groups are tested using Kaplan–Meier curve and log‐rank test.

Differences were considered to be significant when P‐value<0.05. Statistical analyses were carried out using GraphPad Prism (GraphPad Prism, RRID:SCR_002798).

2.16. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018) and are permanently archived in the Concise Guide to PHARMACOLOGY 2019/20 (Alexander et al., 2019).

3. RESULTS

3.1. Effects of dexpramipexole on disease progression and neuropathology in non‐obese diabetic (NOD) mice with progressive experimental autoimmune encephalomyelitis (PPEAE)

Increasing levels of disability in MOG35‐55‐immunized NOD mice has been mostly evaluated for a short period of time, thereby providing no information on disease evolution as well as neuro‐ and immunopathological features during the delayed phases of experimental autoimmune encephalomyelitis (Basso et al., 2008; Farez et al., 2009; Huntington et al., 2006; Ichikawa et al., 2000; Mayo et al., 2016). Hence, in order to carefully define the effects of dexpramipexole in this mouse model of progressive MS, we evaluated neurological functions and neuro/immune parameters up to 6 months after immunization. We decided to adopt a treatment schedule consisting on daily administration of dexpramipexole at 10 mg·kg−1, in keeping with dose regimens well tolerated in humans (Cudkowicz et al., 2011, 2013; He et al., 2014). The drug has been administered orally (p.o.) to be consistent with the use of a neurotherapeutic in a chronic disorder.

In keeping with prior work from our group (Buonvicino et al., 2019), we found that 10‐week‐old NOD mice immunized with MOG35‐55 displayed a gradual worsening of neurological disability resembling a pattern of primary progressive experimental autoimmune encephalomyelitis (PPEAE) (Figures 1a, S1 and S2). Indeed, not a single animal remained stable over the whole observation period. In terms of incidence, we found that 100% of animals reached a score 4. Remarkably, treatment with dexpramipexole delayed the increase in the level of disability (Figure 1a), leading to a concomitant extension of disease duration (Figure 1b). A key parameter used to evaluate the therapeutic efficacy of new drugs in clinical studies with progressive MS patients is confirmed disability progression (Montalban et al., 2017). We therefore also assessed confirmed disability progression in NOD mice treated or not with dexpramipexole. Because of the more rapid disease evolution in mice than in patients, a 4‐day confirmed disability progression was evaluated. Remarkably, a significant difference between vehicle and dexpramipexole‐treated mice was evident (Figure 1c) with a significant reduction in probability of progression showing a HR of 3.133 (1.430–6.862), (P < 0.05). Figure 1d shows that treatment also prolonged survival, with median survival values of 98 and 152.5 days [HR = 3.152 (1.350–7.359), P < 0.05) in vehicle‐ and dexpramipexole‐treated mice, respectively. In keeping with these findings, we found that treatment with dexpramipexole increased the percentage of animals with a low neuroscore and reduced that with a severe neurological impairment both at Days 70 and 140 after immunization, two time points in the first and second half of disease progression (Figure 1e). At these time points, we also evaluated spinal cord neuropathology and found that the mean area of myelin and axonal loss was significantly reduced in the lumbar spinal cord columns of mice treated with dexpramipexole compared to those receiving vehicle (Figure 2a, b). Further, in keeping with the neuroprotective effects of dexpramipexole and its ability to support mitochondrial functioning, we found that the drug counteracted reduction of mtDNA content in the spinal cord of primary progressive experimental autoimmune encephalomyelitis mice at Day 140 post immunization (Figure 2c).

FIGURE 1.

FIGURE 1

Open in a new tab

Effects of dexpramipexole on disease progression and neuropathology in progressive experimental autoimmune encephalomyelitis (PPEAE) non‐obese diabetic (NOD) mice. Effects of daily, oral treatment with dexpramipexole (10 mg·kg−1, daily from Day 20 post immunization) on (a) neurological score and (b) disease duration in MOG35‐55‐immunized NOD mice (n = 15 mice per group; Mann–Whitney test). Kaplan–Meier (c) confirmed disability progression and (d) survival analysis of mice in the experiment described in (a) by log‐rank test. (e) Percentage of vehicle‐ and dexpramipexole‐treated mice with a given neurological score at Days 70 and 140 post immunization in the experiment described in (a). Each point/column represents the mean ± SEM of 15 (vehicle) and 15 (dexpramipexole) animals per group of two independent experiments. *P < 0.05 versus vehicle

FIGURE 2.

FIGURE 2

Open in a new tab

Neurodegeneration and mitochondrial DNA content in spinal cord of progressive experimental autoimmune encephalomyelitis (PPEAE) non‐obese diabetic (NOD) mice treated or not with dexpramipexole. Visualization (a) and quantitation (b) of Luxol Fast Blue or Bielschowsky stained spinal cord sections of MOG35‐55‐immunized NOD mice at Days 70 and 140 post immunization treated or not with dexpramipexole. (c) mtDNA content in the spinal cord of vehicle‐ and dexpramipexole‐treated mice at Day 140 post immunization. In (b) each column is the mean ± SEM of six animals per group, six sections per animal (Student's t‐test ). In (c) each column is the mean ± SEM of five animals per group (Kruskal–Wallis and post hoc Dunn's test). *P < 0.05 versus Crl, # P < 0.05 versus vehicle

3.2. Dexpramipexole does not affect immune responses in progressive experimental autoimmune encephalomyelitis (PPEAE) NOD mice

The ability of dexpramipexole to counteract disease progression in primary progressive experimental autoimmune encephalomyelitis mice prompted us to first ask whether the drug affects antigen‐specific lymphocyte proliferation in these animals. We found that treatment with dexpramipexole did not affect the extent of spleen infiltrates of CD4‐ and CD8‐positive T cells, as well as that of CD45‐positive B lymphocytes and NKp46 expressing NK cells in animals receiving the compound from Days 20 to 70 post immunization (Figure 3a). Similarly, the treatment with dexpramipexole did not affect the extent of spinal cord infiltrates when animals were treated for 15 days from the day of immunization (Figure 3b) or from Days 20 to 70 post immunization (Figure 3c). When the effects of dexpramipexole were evaluated in animals treated for 140 days (when there is maximal score difference), we found that dexpramipexole‐receiving mice showed reduced spinal cord infiltrates (Figure 3d). As for CD4 T cell subtypes, we found that RORyt+‐Th17 and T bet+‐Th1 similarly increased from score 2 to 4 in the spinal cord of vehicle‐ or dexpramipexole‐treated primary progressive experimental autoimmune encephalomyelitis mice (Figure 3e, f). Also, Foxp3+‐Treg and GATA3+‐Th2 cells were similarly represented in the spinal cord of vehicle or dexpramipexole‐treated mice at score 2 and 4, respectively (Figure 3g, h). In keeping with these findings, transcripts for IL10 and TGFβ did not differ in the spinal cord of vehicle or treated mice (Figure 3i). In light of the pathogenetic role of innate immunity in neurodegeneration during MS progression (Wang et al., 2019), we also evaluated the effect of dexpramipexole on microglia and astrocyte activation. We found that dexpramipexole did not affect spinal cord astrocyte and microglia activation in primary progressive experimental autoimmune encephalomyelitis NOD mice exposed to the drug for 140 days (Figure 4a–d). Accordingly, we found that, at variance with dexamethasone, adopted as a positive control, dexpramipexole did not affect LPS‐dependent increase of IL6, IL1β and TNFα transcripts (Figure 5a–c), as well as extracellular release of the corresponding cytokines (Figure 5d–f) by primary cultures of NOD mouse microglia. We also found that a 2‐week treatment with dexpramipexole (10 mg·kg−1 per os, daily) from the day of immunization did not alter antigen‐specific proliferation of lymph node lymphocytes harvested from MOG35‐55‐ or ovalbumin‐immunized mice (Figure 6a). Similarly, MOG35‐55‐dependent proliferation of spleen lymphocytes harvested from score 4 NOD mice was reduced by dexamethasone but not by dexpramipexole directly added to incubating media (Figure 6b). Also, the compound did not reduce the expression of pro‐ (IFNγ and IL13) or anti‐ (IL10) inflammatory cytokines by PMA/ionomycin‐activated cultured mouse spleen lymphocytes (Figure 6c–e). Collectively, these findings suggest that the ability of dexpramipexole to counteract disease progression in primary progressive experimental autoimmune encephalomyelitis NOD mice is not due to an immune suppressive effect.

FIGURE 3.

FIGURE 3

Open in a new tab

Effects of dexpramipexole on adaptive immunity in progressive experimental autoimmune encephalomyelitis (PPEAE) non‐obese diabetic (NOD) mice. Effects of a daily treatment with dexpramipexole (10 mg·kg−1 per os) in the spleen from Days 20 to 70 post immunization (a), in the spinal cord from Days 1 to 15 post immunization (b), in the spinal cord from Days 20 to 70 post immunization (c) and in the spinal cord from Days 20 to 140 post immunization (d) on FACS analysis of CD8, CD4, CD45R (B220), and NKp46 positive cells of NOD immunized mice. (e–h) Effects of dexpramipexole on expression of T bet+‐Th1, RORyt+‐Th17, Foxp3‐Treg and GATA3+‐Th2 in the spinal cord of vehicle‐ or dexpramipexole‐treated PPEAE mice at score 2 and/or 4. (i) Effects of dexpramipexole on IL10 and TGFβ transcript levels in the spinal cord of mice at score 2. In (a)–(d), each column is the mean ± SEM of at least six animals per group. In (e)–(i), each column is the mean ± SEM of at least five animals per group. *P < 0.05 versus Crl, # P < 0.05 versus vehicle (Kruskal–Wallis and post hoc Dunn's test)

FIGURE 4.

FIGURE 4

Open in a new tab

Effects of dexpramipexole on innate immunity in progressive experimental autoimmune encephalomyelitis (PEAE) non‐obese diabetic (NOD) mice. Representative confocal images and quantitation of immunostaining of (a) and (b) astrocytes (GFAP) and (c) and (d) microglia (IBA1) in spinal cord sections of MOG35‐55‐immunized NOD mice at Day 140 post immunization treated or not with dexpramipexole. In (b) and (d), each column is the mean ± SEM of five animals per group, six sections per animal (Kruskal–Wallis and post hoc Dunn's test). *P < 0.05 versus control (Crl)

FIGURE 5.

FIGURE 5

Open in a new tab

Effects of dexpramipexole on mouse microglia activation. Effects of dexpramipexole on IL6, IL1β and TNFα transcripts (a–c) and cytokine release (d–f) of cultured mouse microglia activated with LPS (0.3 μg·ml−1 per 48 h). Data represent the mean ± SEM of five experiments conducted in duplicate. *P < 0.05 versus Crl, # P < 0.05 versus vehicle (Kruskal–Wallis and post hoc Dunn's test)

FIGURE 6.

FIGURE 6

Open in a new tab

Effects of dexpramipexole on adaptive immunity in MOG35–55‐ or ovalbumin‐immunized mice. (a) Effects of a daily treatment (from Day 1 to 15 post immunization) with dexpramipexole (10 mg·kg−1 per os) on lymph node lymphocytes proliferation from MOG35–55‐ or ovalbumin (OVA)‐immunized mice. (b) Effects of dexpramipexole on spleen lymphocytes proliferation harvested from score 4 MOG35‐55‐immunized non‐obese diabetic (NOD) mice and re‐challenged in vitro with MOG35‐55 (20 μg·ml−1). (c–e) Effects of dexpramipexole on the expression of pro‐ (IFNy and IL13) or anti‐ (IL10) inflammatory cytokines by cultured mouse spleen lymphocytes exposed to phorbol 12‐myristate 13‐acetate (PMA)/ionomycin (50 ng ml−1 PMA plus 1 μg·ml−1 ionomycin per 48 h). In each column is the mean ± SEM of at least five animals per group. *P < 0.05 versus Crl, # P < 0.05 versus vehicle (Kruskal–Wallis and post hoc Dunn's test)

3.3. Neuroprotective effects of dexpramipexole

In light of the apparent inability of dexpramipexole to alter acquired or innate immunity, we next embarked upon experiments aimed at providing additional evidence that the drug supports bioenergetics in in vitro models of neurodegeneration. Prior work demonstrates that dexpramipexole binds F1Fo ATP synthase of mitochondria and boosts their bioenergetic efficiency (Alavian et al., 2015). In an attempt to evaluate the effects of dexpramipexole in neurons with long axonal processes, we studied the drug's effects on ATP contents of cultured DRG that typically sprout long axons. We found the dexpramipexole dose‐dependently increased ATP contents of cultured DRG (Figure 7a). Next, to gather further insight into the mechanism(s) of action of dexpramipexole, we repeated the same experiments in the presence of the protonophore carbonyl cyanide 4‐(trifluoromethoxy)phenylhydrazone (FCCP) that typically leads to mitochondrial depolarization and conversion of F1Fo from ATP synthase into ATPase (Zima, Pabbidi, Lipsius, & Blatter, 2013). Remarkably, we found that the reduced ATP contents in DRG exposed FCCP were further reduced by the concomitant presence of dexpramipexole in a concentration‐dependent manner (Figure 7b). These findings suggest that dexpramipexole improves catalysis of F1Fo, irrespectively from its synthase or hydrolase catalysis. We also attempted to model in vitro both white matter degeneration and the “virtual hypoxic milieu” that characterizes axonopathy during MS progression (Sedel et al., 2016). We therefore first studied the effect of dexpramipexole on ATP contents of dissected optic nerve, a structure belonging to the white matter of the brain. We therefore isolated optic nerves of NOD mice and cultured them in a low‐glucose medium to model energy shortage. We found that nerves underwent a drop of ATP content of about 65% after 24‐h incubation and that the presence of dexpramipexole in the culture media counteracted ATP drop in a concentration‐dependent manner (Figure 7c). Next, we also evaluated whether dexpramipexole provides neuroprotection in organotypic mouse cortical cultures exposed to toxins leading to energy shortage. We therefore selected the mitochondrial toxin oligomycin, typically leading to cellular energy failure by inhibiting F1Fo–ATP synthase, or veratridine, a sodium channel opener, leading to deranged sodium homeostasis and intracellular Ca2+ overload. Both conditions recapitulate in part the milieu present in axons exposed to virtual hypoxia during MS progression (Trapp & Stys, 2009). Remarkably, we found that dexpramipexole significantly reduced cytotoxicity prompted by oligomycin or veratridine (Figure 8a–d).

FIGURE 7.

FIGURE 7

Open in a new tab

Effects of dexpramipexole on intact rat dorsal root ganglia (DRG) and mouse optic nerve ATP content. (a) Effects of dexpramipexole on ATP contents of intact rat DRG after 24‐h incubation. (b) Effects of dexpramipexole on ATP contents of intact rat DRG exposed to FCCP (30 μM/6 h). (c) Effects of dexpramipexole on ATP contents of mouse isolated optic nerves after 24 h in vitro. Bars represent the mean ± SEM of seven experiments. *P < 0.05 versus Crl, # P < 0.05 versus vehicle (Kruskal–Wallis and post hoc Dunn's test)

FIGURE 8.

FIGURE 8

Open in a new tab

Effects of dexpramipexole on neuronal injury induced by oligomycin or veratridine in organotypic mouse cortical cultures. Representative images (a) and quantitation (b) of the effect of dexpramipexole (3–10 μM) on cell death (revealed by PI staining) of organotypic mouse cortical cultures exposed to oligomycin (100 nM/48 h). Representative images (c) and quantification (d) of the effect of dexpramipexole (3–10 μM) on cell death (revealed by PI staining) of primary organotypic mouse cortical cultures exposed to veratridine (100 nM/48 h). Bars represent the mean ± SEM of five experiments. *P < 0.05 versus Crl, # P < 0.05 versus vehicle (Kruskal–Wallis and post hoc Dunn's test)

4. DISCUSSION

The present study demonstrates possible therapeutic potential of dexpramipexole in the treatment of progressive MS. In light of the urgent need of drugs able to prevent disease progression in MS patients, our findings suggest that dexpramipexole might be used as a preventive treatment for secondary progressive MS. This is because are data supports the hypothesis that disease progression can be counteracted by targeting the neurodegenerative component by using drug/s to boost mitochondria function. Thus, emphasizing the importance of sustaining neuronal/axonal homeostasis during the development and progression of this disease. From a therapeutic perspective, the present data strengthens the relevance of the pharmacological development of oral, bioenergetic boosting drugs in progressive MS therapy.

Of note, the level of daily dosing of dexpramipexole in primary progressive experimental autoimmune encephalomyelitis NOD mice (10 mg·kg−1) is consistent with that already adopted and tolerated by patients enrolled in past and current trials with dexpramipexole (300–600 mg) (Cudkowicz et al., 2013; Dworetzky et al., 2017; He et al., 2014; Panch et al., 2018) and is much lower than that used (200 mg·kg−1) in a study in mice with amyotrophic lateral sclerosis (Vieira et al., 2014). This information corroborates the translational potential of our findings. Admittedly, the overall effect of dexpramipexole on disease progression is partial and all the animals receiving the drug eventually progressed to the most severe stage. However, it is worth noting that this data is consistent with the potential therapeutic use of a neuroprotective drug in an immune‐mediated CNS disorder as the mice showed a remarkable reduction of disability progression, the latter being a key clinical parameter in progressive MS treatment. We also would like to point out that the ability of dexpramipexole to delay disease progression in mice, along with evidence that immune‐regulating compounds, such as ocrelizumab (Montalban et al., 2017) or siponimod (Kappos et al., 2018) also counteract the increasing level of disability in progressive MS patients, emphasizes the therapeutic potential of combining neurotherapeutic and immunosuppressive strategies in the treatment of progressive MS. Theoretically, such a combination might have synergistic, rather than additive effects in counteracting disease evolution, thereby resulting in a remarkable potentiation of efficacy over that of current therapies prescribed to MS patients. Currently, experiments aimed at evaluating synergism between dexpramipexole and anti‐CD20 biologics in primary progressive experimental autoimmune encephalomyelitis NOD mice are ongoing.

Our study provides compelling evidence that, at least in a mouse model of progressive MS, the increasing level of disability can be counteracted by selective targeting of neurodegeneration without interfering with the autoimmune response. Indeed, we found no evidence that dexpramipexole affects the autoimmune response in the CNS, as well as adaptive or innate immunity in primary progressive experimental autoimmune encephalomyelitis NOD mice. In this regard the ability of dexpramipexole to reduce spinal cord infiltrates in mice receiving the drug for 140 days might indicate immunosuppressive properties. However, we have rule out this possibility because the immunosuppressive effect of dexpramipexole should be also evident at earlier time points when infiltrates are even lower (Buonvicino et al., 2019). Rather, in the light of evidence for neuroinflammation secondary to neurodegeneration in primary progressive experimental autoimmune encephalomyelitis NOD mice (Buonvicino et al., 2019), we reason that reduced extent of immune infiltrates after 140 days should be ascribed to dexpramipexole‐dependent neuroprotection. Further, the inability of the drug to affect immune cell responses is in good agreement with clinical evidence that dexpramipexole‐treated patients do not show symptoms of immunosuppression (Cudkowicz et al., 2011, 2013). Of note, pramipexole, that differs from dexpramipexole in that it potently activates D2/D3 receptors, has an immunosuppressive action in its ability to suppresses experimental autoimmune encephalomyelitis in C57BL/6 mice (Lieberknecht et al., 2017). The different pharmacodynamic profile and immunosuppressive properties of the two isomers indicate that different molecular mechanisms underpin their therapeutic effects in the two models of experimental autoimmune encephalomyelitis. This information also points out that the inability of dexpramipexole to provide immunosuppression precludes its testing in models such as relapsing‐remitting‐experimental autoimmune encephalomyelitis exclusively sustained by the autoimmune attacks to the CNS, thereby emphasizing the specific use of the drug to counteract neurodegeneration during experimental autoimmune encephalomyelitis/MS progression. Further, our findings along with the ability of dexpramipexole to support mitochondrial energy dynamics emphasizes the pathogenetic role of organelle derangement in MS progression (Campbell et al., 2011; de Barcelos, Troxell, & Graves, 2019; Dutta et al., 2006) and, in general, the relevance of the “mitochondrial medicine” (Armstrong, 2009) to progressive MS therapy and prevention. Of note, the original finding that dexpramipexole worsens energy derangement when F1Fo reverses into an ATP‐hydrolysing enzyme provides further evidence for the ability of the drug to target this enzyme and suggests that binding of dexpramipexole to specific F1Fo subunits (Alavian et al., 2015) somehow assists the complex molecular dynamic underling the enzymatic catalysis. Further, the ability of dexpramipexole to counteract oligomycin neurotoxicity is in line with the binding of dexpramipexole to the oligomycin sensitivity‐conferring protein subunits of the F1Fo ATP synthase (Alavian et al., 2015). Notably, the present study along with prior studies showing the ability of dexpramipexole to protect from hypoxic/ischaemic brain damage (Muzzi, Buonvicino, et al., 2018, Muzzi, Gerace, et al., 2018) supports the relevance of the “virtual hypoxia” hypothesis to MS progression, as well as that of drugs boosting mitochondrial ATP production. Development of therapeutic agents able to interfere with initial derangement of sodium homeostasis within demyelinating axons and intra‐axonal Ca2+ deregulation might complement not only bioenergetic drugs but also current immunosuppressive strategies. Dexpramipexole might also be considered as a lead for the identification of more potent F1Fo–ATP synthase activators.

Overall, findings of the present study along with the high tolerability and good safety profile of dexpramipexole suggest that this compound can be harnessed to counteract progression in MS patients, as well as disorders characterized by derangement of axonal homeostasis including immune‐independent central or peripheral neuropathies.

AUTHOR CONTRIBUTIONS

A.C. and D.B. designed the experiments. D.B. and G.R. carried out in vivo experiments. D.B., G.R., M.M. and E.G. carried out in vitro experiments. D.B. and S.P. carried out immunological FACS analysis. D.G. carried out histological analysis. G.R. carried out immunohistochemistry analysis. L.T. performed the statistical analysis. A.C. wrote the paper. All authors reviewed the manuscript.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for Design & Analysis, Immunoblotting and Immunochemistry, Animal Experimentation, and as recommended by funding agencies, publishers and other organisations engaged with supporting research.

Supporting information

Figure S1: Neuroligical Score in 10 week‐old MOG35–55‐immunized NOD mice. Disease progressions of 15 single mice from score 0 to score 4.

Click here for additional data file. (1.1MB, tif)

Figure S2: Neurological Score in 10 week‐old MOG35–55‐immunized NOD mice. Disease progressions of 15 single mice treated with dexpramipexole from day 20 post immunization to score 4.

Click here for additional data file. (117.1KB, TIF)

ACKNOWLEDGEMENTS

This work was supported by grants from Italian Foundation for Multiple Sclerosis 2014/R/6 (recipient A. C.), Regione Toscana Rare Disease Projects‐Heath Projects 2007 and 2009 (recipient A. C.), AIRC and Fondazione CR Firenze under IG 2017 ‐ ID 20451 project (P.I. Alberto Chiarugi).

Buonvicino D, Ranieri G, Pratesi S, et al. Neuroprotection induced by dexpramipexole delays disease progression in a mouse model of progressive multiple sclerosis. Br J Pharmacol. 2020;177:3342–3356. 10.1111/bph.15058

REFERENCES

  1. Alavian, K. N. , Dworetzky, S. I. , Bonanni, L. , Zhang, P. , Sacchetti, S. , Li, H. , … Jonas, E. A. (2015). The mitochondrial complex V‐associated large‐conductance inner membrane current is regulated by cyclosporine and dexpramipexole. Molecular Pharmacology, 87, 1–8. 10.1124/mol.114.095661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alavian, K. N. , Dworetzky, S. I. , Bonanni, L. , Zhang, P. , Sacchetti, S. , Mariggio, M. A. , … Jonas, E. A. (2012). Effects of dexpramipexole on brain mitochondrial conductances and cellular bioenergetic efficiency. Brain Research, 1446, 1–11. 10.1016/j.brainres.2012.01.046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alexander, S. P. H. , Kelly, E. , Mathie, A. , Peters, J. A. , Veale, E. L. , Armstrong, J. F. , … CGTP Collaborators . (2019). The Concise Guide to PHARMACOLOGY 2019/20: Introduction and other protein targets. British Journal of Pharmacology, 176(Suppl 1), S1–S20. 10.1111/bph.14747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Armstrong, J. S. (2009). Mitochondrial medicine: Pharmacological targeting of mitochondria in disease. British Journal of Pharmacology, 151, 1154–1165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Basso, A. S. , Frenkel, D. , Quintana, F. J. , Costa‐Pinto, F. A. , Petrovic‐Stojkovic, S. , Puckett, L. , … Weiner, H. L. (2008). Reversal of axonal loss and disability in a mouse model of progressive multiple sclerosis. The Journal of Clinical Investigation, 118, 1532–1543. 10.1172/JCI33464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Buonvicino, D. , Mazzola, F. , Zamporlini, F. , Resta, F. , Ranieri, G. , Camaioni, E. , … Chiarugi, A. (2018). Identification of the nicotinamide salvage pathway as a new toxification route for antimetabolites. Cell Chemical Biology, 25, 471–482. 10.1016/j.chembiol.2018.01.012 [DOI] [PubMed] [Google Scholar]
  7. Buonvicino, D. , Ranieri, G. , Pratesi, S. , Guasti, D. , & Chiarugi, A. (2019). Neuroimmunological characterization of a mouse model of primary progressive experimental autoimmune encephalomyelitis and effects of immunosuppressive or neuroprotective strategies on disease evolution. Experimental Neurology, 322, 113065. [DOI] [PubMed] [Google Scholar]
  8. Buonvicino, D. , Urru, M. , Muzzi, M. , Ranieri, G. , Luceri, C. , Oteri, C. , … Chiarugi, A. (2018). Trigeminal ganglion transcriptome analysis in 2 rat models of medication‐overuse headache reveals coherent and widespread induction of pronociceptive gene expression patterns. Pain, 159, 1980–1988. 10.1097/j.pain.0000000000001291 [DOI] [PubMed] [Google Scholar]
  9. Campbell, G. , Licht‐Mayer, S. , & Mahad, D. (2019). Targeting mitochondria to protect axons in progressive MS. Neuroscience Letters, 710, 134258. [DOI] [PubMed] [Google Scholar]
  10. Campbell, G. R. , Ziabreva, I. , Reeve, A. K. , Krishnan, K. J. , Reynolds, R. , Howell, O. , … Mahad, D. J. (2011). Mitochondrial DNA deletions and neurodegeneration in multiple sclerosis. Annals of Neurology, 69, 481–492. 10.1002/ana.22109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cassarino, D. S. , Fall, C. P. , Smith, T. S. , & Bennett, J. P. Jr. (1998). Pramipexole reduces reactive oxygen species production in vivo and in vitro and inhibits the mitochondrial permeability transition produced by the parkinsonian neurotoxin methylpyridinium ion. Journal of Neurochemistry, 71, 295–301. 10.1046/j.1471-4159.1998.71010295.x [DOI] [PubMed] [Google Scholar]
  12. Cavone, L. , Felici, R. , Lapucci, A. , Buonvicino, D. , Pratesi, S. , Muzzi, M. , … Chiarugi, A. (2015). Dysregulation of sphingosine 1 phosphate receptor‐1 (S1P1) signaling and regulatory lymphocyte‐dependent immunosuppression in a model of post‐fingolimod MS rebound. Brain, Behavior, and Immunity, 50, 78–86. 10.1016/j.bbi.2015.06.019 [DOI] [PubMed] [Google Scholar]
  13. Cavone, L. , Peruzzi, B. , Caporale, R. , & Chiarugi, A. (2014). Long‐term suppression of EAE relapses by pharmacological impairment of epitope spreading. British Journal of Pharmacology, 171, 1501–1509. 10.1111/bph.12525 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chiarugi, A. , & Moskowitz, M. A. (2003). Poly (ADP‐ribose) polymerase‐1 activity promotes NF‐κB‐driven transcription and microglial activation: Implication for neurodegenerative disorders. Journal of Neurochemistry, 85, 306–317. 10.1046/j.1471-4159.2003.01684.x [DOI] [PubMed] [Google Scholar]
  15. Cudkowicz, M. , Bozik, M. E. , Ingersoll, E. W. , Miller, R. , Mitsumoto, H. , Shefner, J. , … Gribkoff, V. K. (2011). The effects of dexpramipexole (KNS‐760704) in individuals with amyotrophic lateral sclerosis. Nature Medicine, 17, 1652–1656. 10.1038/nm.2579 [DOI] [PubMed] [Google Scholar]
  16. Cudkowicz, M. E. , van den Berg, L. H. , Shefner, J. M. , Mitsumoto, H. , Mora, J. S. , Ludolph, A. , … EMPOWER investigators . (2013). Dexpramipexole versus placebo for patients with amyotrophic lateral sclerosis (EMPOWER): a randomised, double‐blind, phase 3 trial. Lancet Neurology, 12, 1059–1067. 10.1016/S1474-4422(13)70221-7 [DOI] [PubMed] [Google Scholar]
  17. Curtis, M. J. , Alexander, S. , Cirino, G. , Docherty, J. R. , George, C. H. , Giembycz, M. A. , … Ahluwalia, A. (2018). Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers. British Journal of Pharmacology, 175, 987–993. 10.1111/bph.14153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. de Barcelos, I. P. , Troxell, R. M. , & Graves, J. S. (2019). Michondrial dysfunction and multiple sclerosis. Biology (Basel), 8, 37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dutta, R. , McDonough, J. , Yin, X. , Peterson, J. , Chang, A. , Torres, T. , … Trapp, B. D. (2006). Mitochondrial dysfunction as a cause of axonal degeneration in multiple sclerosis patients. Annals of Neurology, 59, 478–489. 10.1002/ana.20736 [DOI] [PubMed] [Google Scholar]
  20. Dworetzky, S. I. , Hebrank, G. T. , Archibald, D. G. , Reynolds, I. J. , Farwell, W. , & Bozik, M. E. (2017). The targeted eosinophil‐lowering effects of dexpramipexole in clinical studies. Blood Cells, Molecules & Diseases, 63, 62–65. [DOI] [PubMed] [Google Scholar]
  21. Farez, M. F. , Quintana, F. J. , Gandhi, R. , Izquierdo, G. , Lucas, M. , & Weiner, H. L. (2009). Toll‐like receptor 2 and poly (ADP‐ribose) polymerase 1 promote central nervous system neuroinflammation in progressive EAE. Nature Immunology, 10, 958–964. 10.1038/ni.1775 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Felici, R. , Buonvicino, D. , Muzzi, M. , Cavone, L. , Guasti, D. , Lapucci, A. , … Chiarugi, A. (2017). Post onset, oral rapamycin treatment delays development of mitochondrial encephalopathy only at supramaximal doses. Neuropharmacology, 117, 74–84. 10.1016/j.neuropharm.2017.01.039 [DOI] [PubMed] [Google Scholar]
  23. Gerace, E. , Landucci, E. , Scartabelli, T. , Moroni, F. , Chiarugi, A. , & Pellegrini‐Giampietro, D. E. (2015). Interplay between histone acetylation/deacetylation and poly (ADP‐ribosyl)ation in the development of ischemic tolerance in vitro. Neuropharmacology, 92, 125–134. 10.1016/j.neuropharm.2015.01.008 [DOI] [PubMed] [Google Scholar]
  24. Gilley, J. , & Coleman, M. P. (2010). Endogenous Nmnat2 is an essential survival factor for maintenance of healthy axons. PLoS Biology, 8, e1000300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Gribkoff, V. K. , & Bozik, M. E. (2008). KNS‐760704 [(6R)‐4,5,6,7‐tetrahydro‐N6‐propyl‐2, 6‐benzothiazole‐diamine dihydrochloride monohydrate] for the treatment of amyotrophic lateral sclerosis. CNS Neuroscience & Therapeutics, 14, 215–226. 10.1111/j.1755-5949.2008.00048.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR . (2018). The IUPHAR/BPS guide to pharmacology in 2018: Updates and expansion to encompass the new guide to immunopharmacology. Nucleic Acids Research, 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. He, P. , Kerr, D. , Marbury, T. , Ries, D. , Farwell, W. , Stecher, S. , … Rogge, M. (2014). Pharmacokinetics of renally excreted drug dexpramipexole in subjects with impaired renal function. Journal of Clinical Pharmacology, 54, 1383–1390. 10.1002/jcph.353 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Huntington, N. D. , Tomioka, R. , Clavarino, C. , Chow, A. M. , Linares, D. , Mana, P. , … Baff, B. C. C. A. (2006). A BAFF antagonist suppresses experimental autoimmune encephalomyelitis by targeting cell‐mediated and humoral immune responses. International Immunology, 18, 1473–1485. 10.1093/intimm/dxl080 [DOI] [PubMed] [Google Scholar]
  29. Ichikawa, M. , Koh, C. S. , Inoue, A. , Tsuyusaki, J. , Yamazaki, M. , Inaba, Y. , … Komiyama, A. (2000). Anti‐IL‐12 antibody prevents the development and progression of multiple sclerosis‐like relapsing–remitting demyelinating disease in NOD mice induced with myelin oligodendrocyte glycoprotein peptide. Journal of Neuroimmunology, 102, 56–66. 10.1016/s0165-5728(99)00153-8 [DOI] [PubMed] [Google Scholar]
  30. Kappos, L. , Bar‐Or, A. , Cree, B. A. C. , Fox, R. J. , Giovannoni, G. , Gold, R. , … EXPAND Clinical Investigators . (2018). Siponimod versus placebo in secondary progressive multiple sclerosis (EXPAND): A double‐blind, randomised, phase 3 study. Lancet, 391, 1263–1273. 10.1016/S0140-6736(18)30475-6 [DOI] [PubMed] [Google Scholar]
  31. Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , & Altman, D. G. (2010). Animal research: Reporting in vivo experiments: The ARRIVE guidelines. British Journal of Pharmacology, 160, 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liang, H. , & Ward, W. F. (2006). PGC‐1α: A key regulator of energy metabolism. Advances in Physiology Education, 30, 145–151. 10.1152/advan.00052.2006 [DOI] [PubMed] [Google Scholar]
  33. Lieberknecht, V. , Junqueira, S. C. , Cunha, M. P. , Barbosa, T. A. , de Souza, L. F. , Coelho, I. S. , … Dutra, R. C. (2017). Pramipexole, a dopamine D2/D3 receptor‐preferring agonist, prevents experimental autoimmune encephalomyelitis development in mice. Molecular Neurobiology, 54, 1033–1045. 10.1007/s12035-016-9717-5 [DOI] [PubMed] [Google Scholar]
  34. Mayo, L. , Cunha, A. P. , Madi, A. , Beynon, V. , Yang, Z. , Alvarez, J. I. , … Weiner, H. L. (2016). IL‐10‐dependent Tr1 cells attenuate astrocyte activation and ameliorate chronic central nervous system inflammation. Brain, 139, 1939–1957. 10.1093/brain/aww113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Montalban, X. , Hauser, S. L. , Kappos, L. , Arnold, D. L. , Bar‐Or, A. , Comi, G. , … ORATORIO Clinical Investigators . (2017). Ocrelizumab versus placebo in primary progressive multiple sclerosis. The New England Journal of Medicine, 376, 209–220. 10.1056/NEJMoa1606468 [DOI] [PubMed] [Google Scholar]
  36. Muzzi, M. , Buonvicino, D. , Urru, M. , Tofani, L. , & Chiarugi, A. (2018). Repurposing of dexpramipexole to treatment of neonatal hypoxic/ischemic encephalopathy. Neuroscience Letters, 687, 234–240. 10.1016/j.neulet.2018.09.064 [DOI] [PubMed] [Google Scholar]
  37. Muzzi, M. , Gerace, E. , Buonvicino, D. , Coppi, E. , Resta, F. , Formentini, L. , … Chiarugi, A. (2018). Dexpramipexole improves bioenergetics and outcome in experimental stroke. British Journal of Pharmacology, 175, 272–283. 10.1111/bph.13790 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ochoa‐Ruiz, E. , Díaz‐Ruiz, R. , Hernández‐Vázquez, A. J. , Ibarra‐González, I. , Ortiz‐Plata, A. , Rembao, D. , … Velázquez‐Arellano, A. (2015). Biotin deprivation impairs mitochondrial structure and function and has implications for inherited metabolic disorders. Molecular Genetics and Metabolism, 116, 204–214. 10.1016/j.ymgme.2015.08.009 [DOI] [PubMed] [Google Scholar]
  39. Panch, S. R. , Bozik, M. E. , Brown, T. , Makiya, M. , Prussin, C. , Archibald, D. G. , … Klion, A. D. (2018). Dexpramipexole as an oral steroid‐sparing agent in hypereosinophilic syndromes. Blood, 132, 501–509. 10.1182/blood-2018-02-835330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rothhammer, V. , Kenison, J. E. , Tjon, E. , Takenaka, M. C. , de Lima, K. A. , Borucki, D. M. , … Quintana, F. J. (2017). Sphingosine 1‐phosphate receptor modulation suppresses pathogenic astrocyte activation and chronic progressive CNS inflammation. Proceedings of the National Academy of Sciences of the United States of America, 114, 2012–2017. 10.1073/pnas.1615413114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sayeed, I. , Parvez, S. , Winkler‐Stuck, K. , Seitz, G. , Trieu, I. , Wallesch, C. W. , … Siemen, D. (2006). Patch clamp reveals powerful blockade of the mitochondrial permeability transition pore by the D2‐receptor agonist pramipexole. The FASEB Journal, 20, 556–558. 10.1096/fj.05-4748fje [DOI] [PubMed] [Google Scholar]
  42. Sedel, F. , Bernard, D. , Mock, D. M. , & Tourbah, A. (2016). Targeting demyelination and virtual hypoxia with high‐dose biotin as a treatment for progressive multiple sclerosis. Neuropharmacology, 110, 644–653. 10.1016/j.neuropharm.2015.08.028 [DOI] [PubMed] [Google Scholar]
  43. Stoppini, L. , Buchs, P.‐A. , & Muller, D. (1991). A simple method for organotypic cultures of nervous tissue. Journal of Neuroscience Methods, 37, 173–182. 10.1016/0165-0270(91)90128-m [DOI] [PubMed] [Google Scholar]
  44. Trapp, B. D. , & Stys, P. K. (2009). Virtual hypoxia and chronic necrosis of demyelinated axons in multiple sclerosis. Lancet Neurology, 8, 280–291. 10.1016/S1474-4422(09)70043-2 [DOI] [PubMed] [Google Scholar]
  45. Vieira, F. G. , LaDow, E. , Moreno, A. , Kidd, J. D. , Levine, B. , Thompson, K. , … Perrin, S. (2014). Dexpramipexole is ineffective in two models of ALS related neurodegeneration. PLoS ONE, 9, e91608 10.1371/journal.pone.0091608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wang, J. , Wang, J. , Wang, J. , Yang, B. , Weng, Q. , & He, Q. (2019). Targeting microglia and macrophages: A potential treatment strategy for multiple sclerosis. Frontiers in Pharmacology, 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zima, A. V. , Pabbidi, M. R. , Lipsius, S. L. , & Blatter, L. A. (2013). Effects of mitochondrial uncoupling on Ca2+ signaling during excitation‐contraction coupling in atrial myocytes. American Journal of Physiology‐Heart and Circulatory Physiology, 304, H983–H993. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: Neuroligical Score in 10 week‐old MOG35–55‐immunized NOD mice. Disease progressions of 15 single mice from score 0 to score 4.

Click here for additional data file. (1.1MB, tif)

Figure S2: Neurological Score in 10 week‐old MOG35–55‐immunized NOD mice. Disease progressions of 15 single mice treated with dexpramipexole from day 20 post immunization to score 4.

Click here for additional data file. (117.1KB, TIF)

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES