Table 1.
Strains, plasmids, and primers used in this study.
| Strains, plasmids, and primers | Description | References |
|---|---|---|
| Strains | ||
| E. coli DH10B | F− endA1 deoR+ recA1 galE15 galK16 nupG rpsL Δ(lac)X74 ϕ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ(mrr-hsdRMS-mcrBC) StrR λ− | Sambrook et al., 1989 |
| E. coli BW25113 | lacI+rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78 rph-1 Δ(araB–D)567 Δ(rhaD–B)568 ΔlacZ4787(::rrnB-3) hsdR514 rph-1 | Datsenko and Wanner, 2000 |
| E. coli JW1702 | E. coli BW25113 with ΔihfA mutation | Baba et al., 2006 |
| E. coli JW3229 | E. coli BW25113 with Δfis mutation | Baba et al., 2006 |
| Plasmids | ||
| pMR1 | CmR; orip15a; Promoter probe vector with mCherry and GFPlva reporters | Guazzaroni and Silva-Rocha, 2014 |
| pMR1-NNNN | pMR1 with a reference promoter with 4 non-regulatory sequences | Monteiro et al., 2018 |
| pMR1-FNNN | pMR1 with a synthetic promoter with a Fis cis-elements at position 4 | This study |
| pMR1-NFNN | pMR1 with a synthetic promoter with a Fis cis-elements at position 3 | This study |
| pMR1-NNFN | pMR1 with a synthetic promoter with a Fis cis-elements at position 2 | This study |
| pMR1-NNNF | pMR1 with a synthetic promoter with a Fis cis-elements at position 1 | This study |
| pMR1-NNFF | pMR1 with a synthetic promoter with Fis cis-elements at positions 2 and 1 | This study |
| pMR1-FNNF | pMR1 with a synthetic promoter with Fis cis-elements at positions 4 and 1 | This study |
| pMR1-FFNN | pMR1 with a synthetic promoter with Fis cis-elements at positions 4 and 3 | This study |
| pMR1-NFFN | pMR1 with a synthetic promoter with Fis cis-elements at positions 3 and 2 | This study |
| pMR1-NFNF | pMR1 with a synthetic promoter with Fis cis-elements at positions 3 and 1 | This study |
| pMR1-FNFN | pMR1 with a synthetic promoter with Fis cis-elements at positions 4 and 2 | This study |
| pMR1-FFNF | pMR1 with a synthetic promoter with Fis cis-elements at positions 4, 3 and 1 | This study |
| pMR1-FNFF | pMR1 with a synthetic promoter with Fis cis-elements at positions 4, 2 and 1 | This study |
| pMR1-NFFF | pMR1 with a synthetic promoter with Fis cis-elements at positions 3, 2 and 1 | This study |
| pMR1-FFFN | pMR1 with a synthetic promoter with Fis cis-elements at positions 4, 3 and 2 | This study |
| pMR1-FFFF | pMR1 with a synthetic promoter with Fis cis-elements at positions 4, 3, 2 and 1 | This study |
| pMR1-INNN | pMR1 with a synthetic promoter with a IHF cis-element at position 4 | Monteiro et al., 2018 |
| pMR1-NINN | pMR1 with a synthetic promoter with a IHF cis-element at position 3 | Monteiro et al., 2018 |
| pMR1-NNIN | pMR1 with a synthetic promoter with a IHF cis-element at position 2 | Monteiro et al., 2018 |
| pMR1-NNNI | pMR1 with a synthetic promoter with a IHF cis-element at position 1 | Monteiro et al., 2018 |
| pMR1-IINN | pMR1 with a synthetic promoter with IHF cis-elements at positions 4 and 3 | Monteiro et al., 2018 |
| pMR1-NIIN | pMR1 with a synthetic promoter with IHF cis-elements at positions 3 and 2 | Monteiro et al., 2018 |
| pMR1-NNII | pMR1 with a synthetic promoter with IHF cis-elements at positions 2 and 1 | Monteiro et al., 2018 |
| pMR1-ININ | pMR1 with a synthetic promoter with IHF cis-elements at positions 4 and 2 | Monteiro et al., 2018 |
| pMR1-NINI | pMR1 with a synthetic promoter with IHF cis-elements at positions 3 and 1 | Monteiro et al., 2018 |
| pMR1-INNI | pMR1 with a synthetic promoter with IHF cis-elements at positions 4 and 1 | Monteiro et al., 2018 |
| pMR1-IIII | pMR1 with a synthetic promoter with IHF cis-elements at positions 4, 3, 2 and 1 | Monteiro et al., 2018 |
| pMR1-FNNI | pMR1 with a synthetic promoter with a IHF cis-element at position 1 and Fis cis- element at position 4 | This study |
| pMR1-NFNI | pMR1 with a synthetic promoter with a IHF cis-element at position 1 and Fis cis- element at position 3 | This study |
| pMR1-NNFI | pMR1 with a synthetic promoter with a IHF cis-element at position 1 and Fis cis- element at position 2 | This study |
| pMR1-NFFI | pMR1 with a synthetic promoter with a IHF cis-element at position 1 and Fis cis- elements at positions 3 and 2 | This study |
| pMR1-FFNI | pMR1 with a synthetic promoter with a IHF cis-element at position 1 and Fis cis- elements at positions 4 and 3 | This study |
| pMR1-IFNN | pMR1 with a synthetic promoter with a IHF cis-element at position 4 and Fis cis- element at position 3 | This study |
| pMR1-INFN | pMR1 with a synthetic promoter with a IHF cis-element at position 4 and Fis cis- element at position 2 | This study |
| pMR1-INNF | pMR1 with a synthetic promoter with a IHF cis-element at position 4 and Fis cis- element at position 1 | This study |
| pMR1-IFFN | pMR1 with a synthetic promoter with a IHF cis-element at position 4 and Fis cis- elements at positions 3 and 2 | This study |
| pMR1-IFNF | pMR1 with a synthetic promoter with a IHF cis-element at position 4 and Fis cis- elements at positions 3 and 1 | This study |
| pMR1-INFF | pMR1 with a synthetic promoter with a IHF cis-element at position 4 and Fis cis- elements at positions 2 and 1 | This study |
| pMR1-IFFF | pMR1 with a synthetic promoter with a IHF cis-element at position 4 and Fis cis- elements at positions 3, 2 and 1 | This study |
| pMR1-IFFI | pMR1 with a synthetic promoter with a IHF cis-elements at positions 4 and 1. Fis cis- elements at positions 3 and 2 | This study |
| pMR1-IFNI | pMR1 with a synthetic promoter with a IHF cis-elements at positions 4 and 1. Fis cis- element at position 3 | This study |
| pMR1-INFI | pMR1 with a synthetic promoter with a IHF cis-elements at positions 4 and 1. Fis cis- element at position 2 | This study |
| Primers | ||
| P1-N5 | AATTCTCGCCTGCTTGTAGTA* | Monteiro et al., 2018 |
| P1-N3 | CGCCTACTACAAGCAGGCGAG | Monteiro et al., 2018 |
| P2-N5 | GGCGTCGCCTGCTTGTAGTA | Monteiro et al., 2018 |
| P2-N3 | GCGGTACTACAAGCAGGCGA | Monteiro et al., 2018 |
| P3-N5 | CCGCTCGCCTGCTTGTAGTA | Monteiro et al., 2018 |
| P3-N3 | CCAATACTACAAGCAGGCGA | Monteiro et al., 2018 |
| P4-N5 | TTGGTCGCCTGCTTGTAGTA | Monteiro et al., 2018 |
| P4-N3 | CAAGTACTACAAGCAGGCGA | Monteiro et al., 2018 |
| P1-I5 | AATTCCAATTTATTGATTTTA* | Monteiro et al., 2018 |
| P1-I3 | CGCCTAAAATCAATAAATTGG | Monteiro et al., 2018 |
| P4-I5 | TTGGCAATTTATTGATTTTA | Monteiro et al., 2018 |
| P4-I3 | CAAGTAAAATCAATAAATTG | Monteiro et al., 2018 |
| P1-F5 | AATTCTGCTCAAAAATTAAGC* | This study |
| P1-F3 | CGCCGCTTAATTTTTGAGCAG | This study |
| P2-F5 | GGCGTGCTCAAAAATTAAGC | This study |
| P2-F3 | GCGGGCTTAATTTTTGAGCA | This study |
| P3-F5 | CCGCTGCTCAAAAATTAAGC | This study |
| P3-F3 | CCAAGCTTAATTTTTGAGCA | This study |
| P4-F5 | TTGGTGCTCAAAAATTAAGC | This study |
| P4-F3 | CAAGGCTTAATTTTTGAGCA | This study |
| CoreP-5 | CTTGAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAG | Monteiro et al., 2018 |
| CoreP-3 | GATCCTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCT* | Monteiro et al., 2018 |
| pMR1-F | CTCGCCCTTGCTCACC | Monteiro et al., 2018 |
| pMR1-R | ACAAGAATTGGGACAACTCC | Monteiro et al., 2018 |
*
Restriction sites are underlined in the primer sequences.