Table 1.

Probes and attached fluorophores used in this study and their properties

Probe	Specificity	Sequence 5′3′	Target site	Fluorophore labelled (dual)	References	Tested isolates/true positives	Tested isolates/true negatives
Eub338	Bacteria	GCTGCCTCCCGTAGGAGT	16S	DY415	Amann et al. (1990)	55/55
Eub338‐II	Planctomycetales	GCAGCCACCCGTAGGTGT	16S	DY415	Daims et al. (1999)
Eub338‐III	Verrucomicrobiales	GCTGCCACCCGTAGGTGT	16S	DY415	Daims et al. (1999)
Alf968	Alphaproteobacteria	GGTAAGGTTCTGCGCGTT	16S	Atto620	Neef (1997)	11/12	25/25
Gam42a	Gammaproteobacteria	GCCTTCCCACATCGTTT	23S	Cy5	Manz et al. (1992)	19/20	23/23
Bac1058	Bacteroidetes	TGAATGGCTGCTTCCAAGCCAACA	23S	Rhodamine RedX	This paper	3/3	17/17
Rho1682	Rhodobacteraceae	CCTTCTCGCGAACTTACGGAGG	23S	DY490	This paper	5/5	15/15
Vib2300	Vibrionaceae	TAACCTCACGATGTCCAACCGTG	23S	Texas RedX	This paper	3/3	9/11
Alt811	Alteromonadaceae	ACAGCTAGTAGACAGCGTTTACG	16S	DY505	This paper	5/6	14/14
Fla891	Flavobacteriaceae	AGTTTGTCAGGAATTGGTAGGCG	23S	DY490	This paper	0/3	1/1
Act1894	Actinobacteria	AGTTACCACCGCCGTTTACTGG	23S	DY490	This paper	1/3
Vib1759	Vibrionaceae	AGCCACCTGGTATCTGCGACT	23S	Texas RedX	This paper	5/5	9/19
Rho420	Rhodobacteraceae	TCAGTAAGGAGTACTTAGCCTTCG	23S	DY490	This paper	1/2

Probes were tested on 55 different cultured isolates to show true positive and true negative hybridizations. Columns 7 and 8 (true positives or true negatives): the first number is the number of cultures that show results as expected, while the second number is the number of cultures tested in total for the specific probe.