Skip to main content
NCBI home page
Human Molecular Genetics logoLink to Human Molecular Genetics
. 2020 Apr 30;29(10):1689–1699. doi: 10.1093/hmg/ddaa082

Pmp22 super-enhancer deletion causes tomacula formation and conduction block in peripheral nerves

Harrison Pantera 1,2,2, Bo Hu 5,2, Daniel Moiseev 5, Chris Dunham 5, Jibraan Rashid 5, John J Moran 1, Kathleen Krentz 4, C Dustin Rubinstein 4, Seongsik Won 1, Jun Li 5, John Svaren 1,3,✉,3
PMCID: PMC7322568  PMID: 32356557

Abstract

Copy number variation of the peripheral nerve myelin gene Peripheral Myelin Protein 22 (PMP22) causes multiple forms of inherited peripheral neuropathy. The duplication of a 1.4 Mb segment surrounding this gene in chromosome 17p12 (c17p12) causes the most common form of Charcot-Marie-Tooth disease type 1A, whereas the reciprocal deletion of this gene causes a separate neuropathy termed hereditary neuropathy with liability to pressure palsies (HNPP). PMP22 is robustly induced in Schwann cells in early postnatal development, and several transcription factors and their cognate regulatory elements have been implicated in coordinating the gene’s proper expression. We previously found that a distal super-enhancer domain was important for Pmp22 expression in vitro, with particular impact on a Schwann cell-specific alternative promoter. Here, we investigate the consequences of deleting this super-enhancer in vivo. We find that loss of the super-enhancer in mice reduces Pmp22 expression throughout development and into adulthood, with greater impact on the Schwann cell-specific promoter. Additionally, these mice display tomacula formed by excessive myelin folding, a pathological hallmark of HNPP, as have been previously observed in heterozygous Pmp22 mice as well as sural biopsies from patients with HNPP. Our findings demonstrate a mechanism by which smaller copy number variations, not including the Pmp22 gene, are sufficient to reduce gene expression and phenocopy a peripheral neuropathy caused by the HNPP-associated deletion encompassing PMP22.

Introduction

Proper myelination by Schwann cells in the peripheral nervous system depends in part on coordinated expression of key structural myelin proteins (1). One of these proteins is encoded by the peripheral myelin protein 22 (PMP22) gene, which is included in a 1.4 Mb duplication that causes the most common form of inherited peripheral neuropathy, called Charcot-Marie-Tooth disease type 1A (CMT1A) (2–5). This progressive sensorimotor polyneuropathy is marked by dysmyelination with shortened internodes (6–9), ultimately leading to degeneration of the myelin and axons, and weakness and atrophy in those denervated limb muscles. The reciprocal 1.4 Mb deletion, resulting in inheritance of only one copy of the PMP22 gene, causes a distinct neuropathy known as hereditary neuropathy with liability to pressure palsies (HNPP) (10–14). HNPP is pathologically characterized by paranodal hypermyelination, causing tomacula formation. The disease commonly manifests as focal sensory loss and muscle weakness when the affected nerves are exposed to mild mechanical compression innocuous to healthy people but resulting in conduction block (failure of action potential propagation) in HNPP patients. Though less severe phenotypically, HNPP may cause severe limb paralysis when asymptomatic patients with unknown diagnosis of HNPP are challenged by strenuous physical activities (15). This imposes a catastrophic risk in a fraction of patients with HNPP.

Given that PMP22 gene dosage variation in either direction may cause peripheral neuropathy, it is of interest to understand endogenous mechanisms that regulate the gene’s expression, which could have therapeutic implications (16). PMP22 encodes one of the most abundantly expressed transcripts in mature peripheral nerve in RNA-seq studies (17). Two major promoters P1 and P2 drive the expression of PMP22 using two alternate non-coding exons (1A or 1B, respectively) and the relative abundance of these alternative transcripts is approximately 3:1 in rodents (18) and 1:1 in human Schwann cells (as recently confirmed in gtexportal.org). The P1 promoter is expressed exclusively in myelinating Schwann cells, although both P1 and P2 transcripts are induced during myelination. In other tissues where PMP22 is expressed at a lower level, the P2 transcript is the major form. Transgenic analysis identified an enhancer region upstream of the P1 promoter (19, 20), known as the late myelination Schwann cell-specific element (LMSE). However, neither the promoters nor the LMSE could recapitulate the large developmental induction of Pmp22 in transgenic assays.

Using ChIP-seq analysis, we had identified a ~40 kb super-enhancer domain termed Pmp22-SE upstream of the rat Pmp22 gene (21, 22). This domain falls within a larger 168 kb region in overlapping upstream duplications (not including the PMP22 gene) identified in patients presenting with mild CMT-like symptoms (23, 24). The enhancers are largely absent from oligodendrocytes where PMP22 is expressed at a much lower level (4, 18, 21), and enhancer marks are significantly diminished after nerve injury when the expression of Pmp22 declines precipitously (25, 26). Using clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9), we deleted this super-enhancer in the S16 rat Schwann cell line and found that the loss of this super-enhancer significantly reduced Pmp22 transcription, with stronger impact on transcription from the Schwann cell-specific P1 promoter (27).

Since its discovery as a causative agent in inherited neuropathies, several studies have probed the molecular function of PMP22 using rodent models possessing Pmp22 deletion (28–35). This led to the discovery that conduction block occurs in these models well before the appearance of segmental demyelination (stripping myelin off the axon) (30). This early ‘functional demyelination’ (31) was traced to a disruption of myelin junction protein complexes by hyperactive p21-activated kinase (PAK1)-driven actin polymerization in the absence of sufficient levels of PMP22 protein (33). Interestingly, the elevated activation of PAK1 observed in Pmp22+/− mice is further increased following ablation of β4 integrin (34), a laminin receptor subunit linked to myelin stability (36, 37). The improper formation of these junction complexes prevents sealing of the myelin sheath, increasing myelin permeability and therefore reducing its capacitance to function as an insulator (31). In the present study, we explore the presentation of this HNPP phenotype at different levels of Pmp22 expression in mice possessing heterozygous and homozygous loss of the upstream super-enhancer.

Results

Effects of Pmp22-SE deletion on Pmp22 expression

To assess the physiological relevance of the Pmp22 super-enhancer in vivo, we used CRISPR-Cas9 to create a 40.5 kb deletion encompassing the super-enhancer domain in C57BL/6 mice (Fig. 1). The figure depicts the position of the super-enhancer relative to ChIP-seq analysis of the active enhancer mark, histone H3K27 acetylation, and the binding sites for EGR2, SOX10 and TAZ transcription factors that have been shown to regulate PMP22 expression (21, 22, 38–40). The shaded super-enhancer region contains injury-sensitive enhancers that are specifically identified in Schwann cells but not oligodendrocytes (21, 22). There are several genes in the vicinity of these enhancers, but the active ones are shown by ChIP-seq analysis of the active promoter mark, histone H3K4 trimethylation (41). The bottom line depicts the approximate homologous endpoints for the minimal region of overlap of the neuropathy-associated duplications identified upstream of human PMP22 (23, 24). Most of the intergenic regions are not conserved, but there are high levels of conservation between rat, mouse and human genomes within the previously defined enhancers (21, 22).

Figure 1.

Figure 1

Open in a new tab

Deletion of Pmp22-SE in mice. ChIP-seq analysis in rat peripheral nerve highlights homologous rat sequence deleted in C57/BL6 mice (blue shaded region, corresponding to mm10 chr11:63, 001, 867-63, 042, 405. The super-enhancer region is marked by H3K27ac and contains binding sites for transcription factors SOX10 and EGR2. The absence of H3K4me3, a histone mark associated with active promoters, indicates that Pmp22-SE-proximal genes Cdrt4 and Tekt3 are not expressed in peripheral nerve.

Upon identification of the desired deletion, litters were generated containing heterozygous and homozygous deletion of the Pmp22 super-enhancer along with wild-type littermates. We collected the sciatic nerves from mice at postnatal Days 0, 10 and 56 (P0, P10 and P56 respectively). The P0 time point precedes the period of active myelination and PMP22 levels along with myelin genes are relatively low in contrast to their peak during active myelination P10-P20. As myelination completes within a few weeks after birth, PMP22 levels and myelin genes decline somewhat but still remain at high levels in mature nerve (42).

At the perinatal time point (P0), we observed no significant change in total Pmp22 messenger RNA (mRNA) in either Pmp22-SE+/− or Pmp22-SE−/− mice relative to wild-type littermates (Fig. 2A). However, when Pmp22 becomes highly induced at both P10 and P56, we found significant reduction in total Pmp22 mRNA in both Pmp22-SE+/− mice (relative to wild-type littermates) and Pmp22-SE−/− mice (relative to both wild-type and Pmp22-SE+/− littermates) (Fig. 2B and C). To evaluate the possibility that this decrease in Pmp22 expression could be attributable to changes in transcription factors regulating Pmp22, we also measured expression of other myelin genes, which are controlled by many of the same transcription factors (16, 21, 22, 43–46). We found no changes in either Mag or Mpz expression at any time point. Finally, we measured expression of the Tvp23b transcript, the next closest expressed gene to the super-enhancer. We found a slight but significant increase in Tvp23b mRNA at P0, although this effect disappeared by P10, indicating that the super-enhancer’s activity is primarily focused on Pmp22. The nearby Tekt3 gene is inactive in Schwann cells (21, 22). In addition to levels of Pmp22 transcript, we also assessed PMP22 protein levels by western blot (Fig. 2D) and observed a commensurate decrease in those levels.

Figure 2.

Figure 2

Open in a new tab

Pmp22-SE contributes to peripheral nerve Pmp22 transcription throughout development. Expression analysis indicates the relative expression of noted genes in heterozygous and homozygous Pmp22-SE deletion mice relative to wild-type littermates at (A) P0 (Wt/Het/Hom n = 3/6/4), (B) P10 (Wt/Het/Hom n = 5/5/3) and (C) P56 (Wt/Het/Hom n = 9/7/4). Relative expression levels in P56 sciatic nerve are shown for the indicated genes. Error bars represent the standard deviation. Statistical analysis denotes results for the comparison of values in heterozygous or homozygous deletion animals to wild-type littermates (*P < 0.05) or comparison of homozygous to heterozygous littermates (§P < 0.05). (D) The western blot shows levels of PMP22 protein along with β-actin as a normalization control in the indicated genotypes. The quantitation of normalized bands relative to wild type is shown in the bar graph.

Because our in vitro model had demonstrated a more pronounced effect of enhancer deletion on the Schwann cell-specific P1 promoter in contrast to the P2 promoter (27), we measured relative expression of transcripts from the P1 and P2 promoters in nerve at these same ages (Fig. 2A–C). At P0, we found a significant decrease in the P1 transcript exclusively in Pmp22-SE−/− mice. At P10 and P56, the P1 transcript was significantly reduced in both Pmp22-SE+/− mice (relative to wild-type littermates) and Pmp22-SE−/− mice (relative to both wild-type and Pmp22-SE+/− littermates). Conversely, although the P2 transcript appeared slightly reduced in P0 nerve, we only observed significant reduction of this transcript in P10 nerve from Pmp22-SE−/− mice. At P56, the P2 transcript was significantly reduced in both Pmp22-SE+/− and Pmp22-SE−/− mice. As the P2 transcript is the predominant Pmp22 transcript in the early postnatal period (18), these results are consistent with our finding that total Pmp22 is not significantly lower in Pmp22-SE+/− or Pmp22-SE−/− mice at P0. Therefore, the super-enhancer does not affect Pmp22 expression in premyelinating Schwann cells. Accordingly, some of the transcription factors that bind to the super-enhancer (such as EGR2) (21, 22) do not become fully induced until later time points (47–49).

We also evaluated additional genes linked to changes in Pmp22 expression in nerve from P56 Pmp22-SE+/− and Pmp22-SE−/− mice (Fig. 2D). Consistent with prior reports showing PAK1 mice protein levels are unchanged in heterozygous Pmp22 deletion mice (33), we detected no significant change in PAK1 mRNA. Plekha1, which was reduced by antisense oligonucleotide therapy targeting the Pmp22 transcript in a rodent model of CMT1A (50), was similarly not affected by deletion of the super-enhancer. We examined Sipa1l2 expression because this was recently identified as a modifier gene for CMT1A. Sipa1l2 expression is SOX10-regulated and positively correlated with Pmp22 expression (51) and was slightly but significantly reduced in Pmp22-SE−/− mice. Socs3 and Id2, which were previously found to be upregulated in Pmp22 knockout mice (52), are both significantly elevated in nerve from P56 super-enhancer deletion mice, with Socs3 transcripts increased in both Pmp22-SE+/− and Pmp22-SE−/− mice and Id2 transcripts increased in Pmp22-SE−/− mice. Finally, ApoE and Abca1, genes related to cholesterol efflux, are both elevated in Pmp22-SE−/− mice at P56, in line with a recent study of Pmp22 KO mice (35).

Tomacula formation and aberrant F-actin polymerization in Pmp22-SE+/− and Pmp22-SE−/− nerve

Previous studies of rodent models of heterozygous Pmp22 deletion (12, 13, 29, 33, 34) showed tomacula formation and aberrant F-actin polymerization. Similarly, there are myelin structural abnormalities in nerve from adult Pmp22-SE+/− and Pmp22-SE−/− nerve (Fig. 4A). In teased nerve fibers, increased tomacula in both Pmp22-SE+/− and Pmp22-SE−/− mice are evident relative to wild-type littermates (Fig. 3A and B). Consistent with the elevated actin polymerization in heterozygous Pmp22 knockout mice (33), F-actin was elevated at mesaxons (Fig. 3C). We also measured F-actin levels in Schmidt-Lanterman incisures. Again, it was increased in both heterozygous and homozygous Pmp22-SE deletion mice (fluorescence intensity: Pmp22-SE+/+ 630.5 ± 71.9 versus Pmp22-SE+/− 958.0 ± 88.1 or Pmp22-SE−/− 1105.7 ± 225.0; 80–100 fibers per mouse; n = 3 mice per genotypic group; P < 0.05). Notably, with respect to tomaculous prevalence, the proportion of F-actin positive mesaxons and F-actin fluorescence intensity in incisures, there were no significant differences between Pmp22-SE+/− and Pmp22-SE−/− mice (Fig. 3D).

Figure 4.

Figure 4

Open in a new tab

Morphometric analysis demonstrates axonal loss in Pmp22-SE deletion mouse sciatic nerve. (A) Images of the semithin section were taken from 3- to 5-month-old wild-type, Pmp22-SE+/− and Pmp22-SE−/− nerve. (B) Axon-diameter distributions in 3- to 5-month-old wild-type, Pmp22-SE+/− and Pmp22-SE−/− nerve. (C) g-Ratios were plot against axon diameters. The slope of the scatter plot reflects myelin thickness.

Figure 3.

Figure 3

Open in a new tab

Increased tomacula formation and actin polymerization in Pmp22-SE deletion mouse sciatic nerve. (A) Images depicting tomacula formation in teased nerves of 3- to 5-month-old wild-type, Pmp22-SE+/− and Pmp22-SE−/− nerve. (B) The quantitation of prevalence of tomacula as the percentage of counted nerve fibers (150–300 fibers per mouse, n = 3 mice per genotypic group). (C) Teased nerve fibers of mouse sciatic nerve were stained with fluorescent phalloidin. Arrows indicate increases in Rhodamine-labeled F-actin polymerization at and mesaxons. (D) Quantification of the prevalence of F-actin-positive mesaxons in 3- to 5-month-old wild-type, Pmp22-SE+/− and Pmp22-SE−/− nerve. Scale bars = 20 μm.

Morphometric analysis demonstrates axon loss in Pmp22-SE+/− and Pmp22-SE−/− nerve

Axon loss has been observed in humans with HNPP and Pmp22+/− mice during aging (13, 14, 53), even though the axon loss was subtle or not significant in some Pmp22+/− mice prior to 6 months of age (33). We therefore performed morphometric analysis in Pmp22-SE+/− and Pmp22-SE−/− mice (Fig. 4A, 4–6 month old; n = 5 for each genotypic group). Again, results confirmed a mild, but statistically significant decrease of axon density in Pmp22-SE+/−, compared with that in wild-type nerves. As expected, the axon loss was more severe in Pmp22-SE−/− nerves, (Table 2). This axon loss predominantly affected the small and intermediate myelinated nerve fibers, whereas larger nerve fibers were increased because of tomacula (Fig. 4B). The increase was in line with the analysis of g-ratio (axon diameter divided by outer diameter of the myelinated nerve fiber, which reflects myelin thickness). It showed a significant decrease of g-ratio in larger diameter nerve fibers (Table 2 and Fig. 4C).

Table 2.

Axon density and g-ratio in Pmp22-SE deletion sciatic nerve

Pmp22-SE+/+ Pmp22-SE+/− Pmp22-SE−/−
Mouse number 5 5 5
Fiber number 8503 7243 5196
Axon density 19 939 ± 1328 16 904 ± 1556 12 958 ± 1394
P-value 0.018a 0.000a; 0.006b
g-Ratio 0.67 ± 0.01 0.61 ± 0.03 0.54 ± 0.04
P-value 0.021a 0.004a; 0.038b
Open in a new tab

a Pmp22-SE+/− or Pmp22-SE−/− versus Pmp22-SE+/+.

b Pmp22-SE−/− versus Pmp22-SE+/−.

Impaired recovery from conduction block in Pmp22-SE+/− and Pmp22-SE−/− nerve

The heterozygous deletion of Pmp22 renders nerve susceptible to conduction block induced by mechanical compression (30). We therefore employed a model of mechanically induced nerve compression to establish whether this phenotype is present at different levels of reduced Pmp22 expression resulting from heterozygous or homozygous deletion of Pmp22-SE. This was carried out by applying a precalibrated vessel clamp to compress the surgically exposed mouse sciatic nerve. Electrical stimuli were delivered to the nerve both distal and proximal to the compression site. Over time, the amplitude of nerve responses by proximal stimulation gradually declined. The latency for the decline to reach 60% of amplitude by the distal stimulation was used as a marker to compare the nerve susceptibility to mechanical compression between wild-type and mutant mice. Consistent with prior work (30), we observed significantly shorter latency in achieving 60% conduction block in mechanically compressed nerves from both Pmp22-SE+/− and Pmp22-SE−/− mice compared with that in wild-type mice (Fig. 5A).

Figure 5.

Figure 5

Open in a new tab

Impaired recovery from conduction block in Pmp22-SE−/− mouse sciatic nerve. (A) Time to achieve 60% conduction block in 3- to 5-month-old wild-type, Pmp22-SE+/− and Pmp22-SE−/− nerves (P < 0.05; n = 12 mice per genotypic group). (B) CMAP amplitudes before nerve compression (baseline) and at 1, 3, 7 and 14 days following the compression. Two-way ANOVA with repeated measures showed a significant effect of genotype (F2,30 = 60.96, P < 0.0001) in CMAP amplitudes at all time points (F3.177,95.30 = 7.665, P < 0.0001), but not for CMAP recovery (F8,120 = 1.309, P > 0.05). Tukey’s multiple comparisons showed significantly smaller CMAPs at all time points between Pmp22-SE−/− and wild-type mice (P < 0.0001), but not different between Pmp22-SE+/− and wild-type mice (P > 0.05). (C) Proximal/distal CMAP amplitude ratio (a measure of conduction block). The two-way ANOVA showed a significant effect of genotype (F2,30 = 8.402, P < 0.01) and recovery (F6,90 = 6.170, P < 0.0001) in P/D ratio. This difference in Day 1 was significant between Pmp22-SE−/− and wild-type (P < 0.0001) or between Pmp22-SE−/− and Pmp22-SE+/− mice (P < 0.01), but not significant for the remaining time points (P > 0.05). (D) Nerve conduction velocity. The ANOVA showed a significant effect of genotype (F2,30 = 82.01, P < 0.0001), over time (F2.704,81.13 = 4.958, P < 0.01) and recovery (F8,120 = 2.509, P < 0.05). Tukey’s multiple comparisons showed significantly decreased CVs at all recovery time points in Pmp22-SE−/− animals in contrast to wild-type (P < 0.01) but not between wild-type and Pmp22-SE+/− animals at any time point (P > 0.05).

To evaluate the ability of these mice to recover from conduction block, we measured compound muscle action potential (CMAP) amplitude and nerve conduction velocity at Days 1, 3, 7 and 14 following mechanical nerve compression. In this method, surgically exposed sciatic nerve was compressed, and CMAP amplitudes were measured using both proximal stimulation (i.e. requiring transmission across compression site) and distal stimulation (i.e. with stimulus and recording being on the same side relative to the compressed point). Interestingly, despite Pmp22-SE+/− and Pmp22-SE−/− mice showing similar pathological changes, we observed significant differences in recovery from conduction block only in Pmp22-SE−/− mice. In wild-type and Pmp22-SE+/− mice, proximal CMAP amplitudes declined relative to distal stimulation at Days 1 and 3 before recovering to baseline levels by Day 14, and no significant differences were apparent between these two groups (Fig. 5B). In contrast, Pmp22-SE−/− mice displayed much lower baseline CMAP amplitude. Although CMAP amplitude in these mice similarly decline from baseline to Day 3, there was no recovery as of Day 14 (Fig. 5B). The changes were quantitated using the proximal/distal CMAP amplitude ratio, which helps to control for differences in probe placement across multiple recording sessions. We observed significantly reduced P/D ratio only in Pmp22-SE−/− until Day 7 after nerve compression (Fig. 5C). Similarly, although wild-type and Pmp22-SE+/− mice displayed no significant changes in conduction velocity over this period, mice possessing homozygous deletion of Pmp22-SE displayed reduced conduction velocity at Days 1 and 3 after compression, with recovery to baseline levels by Day 7 (Fig. 5D).

Discussion

In this study, we describe a new mouse model of reduced Pmp22 expression that recapitulates phenotypic and pathological hallmarks of HNPP observed in previous rodent models of heterozygous Pmp22 loss (12, 13, 31). We have demonstrated that a distal super-enhancer domain previously shown to regulate Pmp22 expression in vitro is similarly required for full endogenous expression in vivo. We find that the super-enhancer contributes to gene expression at all time points evaluated and appears to selectively regulate Pmp22 expression without affecting the nearby Tvp23b gene. As in our cell culture model (27), transcription from the Schwann cell-specific P1 promoter is more significantly affected by the loss of this super-enhancer throughout development. The histone H3K27 acetylation that marks the super-enhancer in peripheral nerve is absent in the central nervous system (21, 54), and this super-enhancer is required for the high expression of the Schwann cell-specific P1 promoter. However, super-enhancer deletion did not reduce total Pmp22 mRNA levels to <30% at any age, indicating that other regulatory elements, such as the intronic regulatory element and promoter proximal regions (20–22, 46), are also involved in maintaining proper levels of Pmp22 expression.

Previous work evaluating ‘functional demyelination’ in Pmp22+/− models has developed a model in which reduction of PMP22 protein disrupts the formation of junction protein complexes and produces hyper-permeable myelin, leading to lost internodal current and conduction block (31, 33). Here, we demonstrate a Pmp22-dosage-dependent progression of this mechanism, including Pmp22-dosage-dependent axon loss. Although both Pmp22-SE+/− and Pmp22-SE−/− mice also displayed tomacula and abnormal F-actin assembly, the functional consequences of conduction block and its recovery were only visible in nerves from Pmp22-SE−/− mice. Together, these findings suggest that severity of the neuropathy is a function of the level of Pmp22 expression.

Several different agents have been developed that can reduce PMP22 expression and improve the CMT1A neuropathy in rodent models (16, 50, 55, 56), some of which have entered clinical trials (57, 58). It has been appreciated that there is a potential risk in the development of therapeutics for CMT1A if an overly efficacious treatment reduces a patient’s level of Pmp22 expression below normal levels in healthy individuals (59). However, it remains to be determined whether development of HNPP symptoms requires reduced PMP22 levels during early myelin formation or whether a switch to reduced expression later in life is sufficient to induce the disease. In addition, a novel skin biopsy assay has been developed that can be used to evaluate levels of PMP22 expression as a target engagement assay in clinical trials (60).

In summary, we have found that a super-enhancer domain previously identified in a cultured rat Schwann cell line is an important regulator of Pmp22 expression in vivo. Our data show that the loss of this super-enhancer is sufficient to induce the morphological and electrophysiological phenotype commonly associated with HNPP, which is also Pmp22-dosage dependent. This evidence indirectly supports the notion that previously observed upstream duplications, inclusive of the super-enhancer but not the PMP22 gene itself (23, 24), can induce a mild form of neuropathy by promoting overexpression of PMP22. More importantly, the mouse model offers a new tool to scale the levels of PMP22 in vivo and examines how dosages of PMP22 affect different aspects of pathogenic mechanisms in HNPP.

Materials and Methods

Experimental animals

All procedures described here were conducted in compliance with the Institutional Animal Care and Use Committees at University of Wisconsin and Wayne State University. C57BL/6 embryos and CRISPR/Cas9 reagents were electroporated at the University of Wisconsin-Madison Biotechnology Center. Guide RNA sequences are as follows: 5′-GAGGCTCAGCAAGGTCACGGGGG-3′ for upstream target; 5′-GCTGCTGAGGGGCAGATTCGGGG-3′ for downstream target. Mice from implanted embryos were genotyped to detect successful deletion using primers flanking the excised sequence: 5′-ACACACACACACATGCCCAGTAAATAG-3′ and 5′-TTCTCCGTGACTTCTGCCTCCTCATTC-3′. A single founder was identified, and F1 and F2 generation mice were backcrossed to C57/BL6 mice to generate heterozygote breeding pairs, which produced wild-type mice along with heterozygous and homozygous deletion of the Pmp22 super-enhancer.

Genotyping

Genomic DNA was isolated from tail snips using the DNeasy Blood and Tissue kit (Qiagen). Genotyping assay was performed using GoTaq master mix (Promega) with the shared primer 5′-CATTTTGGGATGTGCTCTTAGTCT-3′ and genotype-specific reverse primers: 5′-CAAGAGAAGGTTAAAGCTATGCCA-3′ (for detection of deletion postrepair junction) and 5′-CATTCAGTGAAGGAGAACAACGG-3′ (for amplification of wild-type sequence). Sex determination of P0 mice was performed via PCR with the following primers: 5′-TGCAGCTCTACTCCAGTCTTG-3′ and 5′-GATCTTGATTTTTAGTGTTC-3′ to amplify a portion of the Sry gene on the Y chromosome.

Reverse transcription-quantitative polymerase chain reaction

RNA was isolated from sciatic nerves using TRIzol reagent (Ambion) and the RNEasy MinElute cleanup kit (Qiagen) according to the manufacturer’s protocol. RNA was converted to complementary DNA using MMLV reverse transcriptase (Invitrogen). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) experiments were performed using Power SYBR Green master mix (Thermo Fisher Scientific) on the StepOne Plus and/or ViiA7 systems (Applied Biosystems). Relative expression was calculated using the comparative Ct method (61). Primers are listed in Table 1.

Table 1.

qPCR primers used

Gene Forward Reverse
Actb GGGATGTTTGCTCCAACCAA GGCGCTTTTGACTCAGGATTTA
Cnp GCACCATCATCTGAGGGTTCA TGGAAGGCATGTTGCTGTGT
Gldn CCTCCACCTCCCACATTATTT CAGAGTCTGAGGTGTCTCTTTC
Pmp22pan GGCAATGGACACACGACTGA GCTCCCAAGGCGGATGT
Pmp22-P1 TTGACTGCAGAGACATCCAAGTG GGGCTCGGGATCAGAGGA
Pmp22-P2 AGATAGCTGTCCCTTTGAACTGAAA GTTGGGCTCGGGATCAGA
Mag GTCCGGCACCATACAACTGA TGGTTCCCCCGGAAGTG
Mpz CCCTGGCCATTGTGGTTTAC CCATTCACTGGACCAGAAGGAG
Tvp23b TGGCTACGTCGTATCTTGGA GAATCGTGTCCATTGCTCCC
Pak1 AACCGCTGTCTTGAGATGGA GCAGCAATCAGTGGAGTCAG
Plekha1 TAGCCCTGAAGAGATGCACA GGACGGACAGTGAATTTGGG
Sipa1L2 GGAACCTGAAGTGACGGAATG ATCTTTGGATAGGACATGCTGAG
Socs3 GGAGATTTCGCTTCGGGACT GGAAACTTGCTGTGGGTGAC
Id2 ACCACCCTGAAGACGGACAT GAATTCAGACGCCTGCAAGG
Abca1 CAACAAACTCTGCCACGTGA GCTCACTTGAACTTTGCCCA
ApoE CAGTGGCCCAGGAGAATCAAT ATGTTGTTGCAGGACAGGAGAA
Pmp2 TGCTGGATGGGAGAATGGTAG TGCAGACCACACCCTTCATTAT
Open in a new tab

Nerve compression and nerve conduction studies

Nerve conduction studies were performed as described previously (30, 33). Sciatic nerve was surgically exposed and compressed with a precalibrated vessel clamp (cat#: TKF-1-15g, AROS Surgical Instruments Co.). CMAP was recorded with both proximal and distal stimulation, and the proximal/distal (P/D) CMAP amplitude ratio was calculated to define the degrees of conduction block and minimize effects of variation in electrode placement for multiple trials with the same animal.

Semithin section

As described (62), tissues were fixed with 4% paraformaldehyde. Nerves were embedded in Epon and sectioned to semithin sections for morphometric analysis.

Teased nerve fiber imaging and immunofluorescence

As described (31, 33), nerves were fixed in 4% paraformaldehyde and teased into individual nerve fibers on glass slides. Immunostaining with antibodies against myelin proteins was visualized under confocal microscopy. Tomacula were counted under light microscopy. For F-actin staining, teased fibers were stained with rhodamine-conjugated phalloidin and imaged with a fluorescent microscope.

Morphometric analysis

Morphometric analysis was performed as described previously (63). All ×63 bright field images of mouse sciatic nerves were taken using a Leica microscope. A trained deep learning model was applied to the images to generate semantic segmentations with isolated myelin or axon. Each nerve fiber’s inner area around the axon and outer areas (axon + myelin) were measured. Then, each fiber’s diameter, myelin thickness and g-ratio were calculated. Myelinated fiber density, myelin thickness and g-ratio were analyzed using paired two-tailed t-tests (n = 5 for each of the 3 genotypes) (Table 2). A histogram with 1 μm bin size reflecting a proportion of fibers of certain diameter was generated for each genotype to better visualize axon loss of specific fiber diameters in the mutant nerves.

Western blot

To prepare western blot lysates, a single nerve from each study animal was briefly thawed on ice then disrupted with a microcentrifuge pestle in 200 μl of ×1 Laemmli buffer containing 5% β-mercaptoethanol v/v, protease (Sigma P8340) and phosphatase inhibitors. Following tissue lysis, samples were heated at 95°C for 5 min and then centrifuged at 15 000g for 15 min. Supernatants were run on a 12% TEO-Tricine SDS gel (Expedeon BCG01212) and transferred to nitrocellulose membrane (Amersham Protran 10 600 015). Membrane was blocked with 5% non-fat dry milk, then incubated overnight at 4°C with primary antibodies: Mouse anti-ACTB (AbClonal AC004) 1:5000 and Rabbit anti-PMP22 (LsBio LS-C383645) 1:250. Membrane was washed 3 times with Tris-buffered saline with Tween 20 (TBST), then incubated for 1 h at room temperature with secondary antibodies: Gt anti-Mouse IR 800CW (Licor 925-32210) 1:10 000 and Donkey anti-Rabbit IR 800CW (Licor 925-32213) 1:10 000. Blot was imaged using the Odyssey imaging system, and PMP22 bands were normalized to ACTB.

Statistical analysis

The data are represented as the mean ± SD. Statistical analysis was performed using SPSS software. P-values were obtained from the Student’s two-tailed t-test or repeated measures analysis of variance (P < 0.05 is considered to be statistically significant).

Acknowledgements

We wish to thank members of our laboratories for feedback on this study.

Funding

The National Institutes of Health (RO1 NS083841 to J.S., R01 NS066927 and R01 NS115748 to J.L. and U54 core grant HD090256).

Conflict of Interest: None declared.

References

  • 1. Pereira J.A., Lebrun-Julien F. and Suter U. (2012) Molecular mechanisms regulating myelination in the peripheral nervous system. Trends Neurosci., 35, 123–134. [DOI] [PubMed] [Google Scholar]
  • 2. Lupski J.R., Oca-Luna R.M., Slaugenhaupt S., Pentao L., Guzzetta V., Trask B.J., Saucedo-Cardenas O., Barker D.F., Killian J.M., Garcia C.A. et al. (1991) DNA duplication associated with Charcot-Marie-Tooth disease type 1A. Cell, 66, 219–232. [DOI] [PubMed] [Google Scholar]
  • 3. Raeymaekers P., Timmerman V., Nelis E., De Jonghe P., Hoogendijk J.E., Baas F., Barker D.F., Martin J.J., De Visser M. and Bolhuis P.A. (1991) Duplication in chromosome 17p11.2 in Charcot-Marie-Tooth neuropathy type 1a (CMT 1a). The HMSN Collaborative Research Group. Neuromuscul. Disord., 1, 93–97. [DOI] [PubMed] [Google Scholar]
  • 4. Snipes G.J., Suter U., Welcher A.A. and Shooter E.M. (1992) Characterization of a novel peripheral nervous system myelin protein (PMP-22/SR13). J. Cell Biol., 117, 225–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Patel P.I., Roa B.B., Welcher A.A., Schoener-Scott R., Trask B.J., Pentao L., Snipes G.J., Garcia C.A., Francke U., Shooter E.M. et al. (1992) The gene for the peripheral myelin protein PMP-22 is a candidate for Charcot-Marie-Tooth disease type 1A. Nat. Genet., 1, 159–165. [DOI] [PubMed] [Google Scholar]
  • 6. Saporta M.A., Katona I., Lewis R.A., Masse S., Shy M.E. and Li J. (2009) Shortened internodal length of dermal myelinated nerve fibres in Charcot-Marie-Tooth disease type 1A. Brain, 132, 3263–3273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Gabreëls-Festen A. and Wetering R.V. (1999) Human nerve pathology caused by different mutational mechanisms of the PMP22 gene. Ann. N. Y. Acad. Sci., 883, 336–343. [PubMed] [Google Scholar]
  • 8. Gabreëls-Festen A.A., Bolhuis P.A., Hoogendijk J.E., Valentijn L.J., Eshuis E.J. and Gabreëls F.J. (1995) Charcot-Marie-Tooth disease type 1A: morphological phenotype of the 17p duplication versus PMP22 point mutations. Acta Neuropathol., 90, 645–649. [DOI] [PubMed] [Google Scholar]
  • 9. Li J., Bai Y., Ghandour K., Qin P., Grandis M., Trostinskaia A., Ianakova E., Wu X., Schenone A., Vallat J.M. et al. (2005) Skin biopsies in myelin-related neuropathies: bringing molecular pathology to the bedside. Brain, 128, 1168–1177. [DOI] [PubMed] [Google Scholar]
  • 10. Chance P.F., Alderson M.K., Leppig K.A., Lensch M.W., Matsunami N., Smith B., Swanson P.D., Odelberg S.J., Disteche C.M. and Bird T.D. (1993) DNA deletion associated with hereditary neuropathy with liability to pressure palsies. Cell, 72, 143–151. [DOI] [PubMed] [Google Scholar]
  • 11. Nicholson G.A., Valentijn L.J., Cherryson A.K., Kennerson M.L., Bragg T.L., DeKroon R.M., Ross D.A., Pollard J.D., McLeod J.G. and Bolhuis P.A. (1994) A frame shift mutation in the PMP22 gene in hereditary neuropathy with liability to pressure palsies. Nat. Genet., 6, 263–266. [DOI] [PubMed] [Google Scholar]
  • 12. Adlkofer K., Martini R., Aguzzi A., Zielasek J., Toyka K.V. and Suter U. (1995) Hypermyelination and demyelinating peripheral neuropathy in Pmp22-deficient mice. Nat. Genet., 11, 274–280. [DOI] [PubMed] [Google Scholar]
  • 13. Adlkofer K., Frei R., Neuberg D.H., Zielasek J., Toyka K.V. and Suter U. (1997) Heterozygous peripheral myelin protein 22-deficient mice are affected by a progressive demyelinating tomaculous neuropathy. J. Neurosci., 17, 4662–4671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Li J., Ghandour K., Radovanovic D., Shy R.R., Krajewski K.M., Shy M.E. and Nicholson G.A. (2007) Stoichiometric alteration of PMP22 protein determines the phenotype of hereditary neuropathy with liability to pressure palsies. Arch. Neurol., 64, 974–978. [DOI] [PubMed] [Google Scholar]
  • 15. Horowitz S.H., Spollen L.E. and Yu W. (2004) Hereditary neuropathy with liability to pressure palsy: fulminant development with axonal loss during military training. J. Neurol. Neurosurg. Psychiatry, 75, 1629–1631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Pantera H., Shy M.E. and Svaren J. (1726) Regulating PMP22 expression as a dosage sensitive neuropathy gene. Brain Res., 2020, 146491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ma K.H., Duong P., Moran J.J., Junaidi N. and Svaren J. (2018) Polycomb repression regulates Schwann cell proliferation and axon regeneration after nerve injury. Glia, 66, 2487–2502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Suter U., Snipes G.J., Schoener-Scott R., Welcher A.A., Pareek S., Lupski J.R., Murphy R.A., Shooter E.M. and Patel P.I. (1994) Regulation of tissue-specific expression of alternative peripheral myelin protein-22 (PMP22) gene transcripts by two promoters. J. Biol. Chem., 269, 25795–25808. [PubMed] [Google Scholar]
  • 19. Maier M., Berger P., Nave K.A. and Suter U. (2002) Identification of the regulatory region of the peripheral myelin protein 22 (PMP22) gene that directs temporal and spatial expression in development and regeneration of peripheral nerves. Mol. Cell. Neurosci., 20, 93–109. [DOI] [PubMed] [Google Scholar]
  • 20. Maier M., Castagner F., Berger P. and Suter U. (2003) Distinct elements of the peripheral myelin protein 22 (PMP22) promoter regulate expression in Schwann cells and sensory neurons. Mol. Cell. Neurosci., 24, 803–817. [DOI] [PubMed] [Google Scholar]
  • 21. Lopez-Anido C., Poitelon Y., Gopinath C., Moran J.J., Ma K.H., Law W.D., Antonellis A., Feltri M.L. and Svaren J. (2016) Tead1 regulates the expression of peripheral myelin protein 22 during Schwann cell development. Hum. Mol. Genet., 25, 3055–3069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Jones E.A., Brewer M.H., Srinivasan R., Krueger C., Sun G., Charney K.N., Keles S., Antonellis A. and Svaren J. (2012) Distal enhancers upstream of the Charcot-Marie-Tooth type 1A disease gene PMP22. Hum. Mol. Genet., 21, 1581–1591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Weterman M.A., Ruissen F., Wissel M., Bordewijk L., Samijn J.P., Pol W.L., Meggouh F. and Baas F. (2010) Copy number variation upstream of PMP22 in Charcot-Marie-Tooth disease. Eur. J. Hum. Genet., 18, 421–428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zhang F., Seeman P., Liu P., Weterman M.A., Gonzaga-Jauregui C., Towne C.F., Batish S.D., De Vriendt E., De Jonghe P., Rautenstrauss B. et al. (2010) Mechanisms for nonrecurrent genomic rearrangements associated with CMT1A or HNPP: rare CNVs as a cause for missing heritability. Am. J. Hum. Genet., 86, 892–903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Hung H.A., Sun G., Keles S. and Svaren J. (2015) Dynamic regulation of Schwann cell enhancers after peripheral nerve injury. J. Biol. Chem., 290, 6937–6950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Welcher A.A., Suter U., De Leon M., Snipes G.J. and Shooter E.M. (1991) A myelin protein is encoded by the homologue of a growth arrest-specific gene. Proc. Natl. Acad. Sci. U. S. A., 88, 7195–7199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Pantera H., Moran J.J., Hung H.A., Pak E., Dutra A. and Svaren J. (2018) Regulation of the neuropathy-associated Pmp22 gene by a distal super-enhancer. Hum. Mol. Genet., 27, 2830–2839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Amici S.A., Dunn W.A., Murphy A.J., Adams N.C., Gale N.W., Valenzuela D.M., Yancopoulos G.D. and Notterpek L. (2006) Peripheral myelin protein 22 is in complex with alpha6beta4 integrin, and its absence alters the Schwann cell basal lamina. J. Neurosci., 26, 1179–1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Amici S.A., Dunn W.A. and Notterpek L. (2007) Developmental abnormalities in the nerves of peripheral myelin protein 22-deficient mice. J. Neurosci. Res., 85, 238–249. [DOI] [PubMed] [Google Scholar]
  • 30. Bai Y., Zhang X., Katona I., Saporta M.A., Shy M.E., O'Malley H.A., Isom L.L., Suter U. and Li J. (2010) Conduction block in PMP22 deficiency. J. Neurosci., 30, 600–608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Guo J., Wang L., Zhang Y., Wu J., Arpag S., Hu B., Imhof B.A., Tian X., Carter B.D., Suter U. et al. (2014) Abnormal junctions and permeability of myelin in PMP22-deficient nerves. Ann. Neurol., 75, 255–265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Rosso G., Liashkovich I., Gess B., Young P., Kun A. and Shahin V. (2014) Unravelling crucial biomechanical resilience of myelinated peripheral nerve fibres provided by the Schwann cell basal lamina and PMP22. Sci. Rep., 4, 7286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Hu B., Arpag S., Zhang X., Möbius W., Werner H., Sosinsky G., Ellisman M., Zhang Y., Hamilton A., Chernoff J. et al. (2016) Tuning PAK activity to rescue abnormal myelin permeability in HNPP. PLoS Genet., 12, e1006290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Poitelon Y., Matafora V., Silvestri N., Zambroni D., McGarry C., Serghany N., Rush T., Vizzuso D., Court F.A., Bachi A. et al. (2018) A dual role for integrin α6β4 in modulating hereditary neuropathy with liability to pressure palsies. J. Neurochem., 145, 245–257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Zhou Y., Miles J.R., Tavori H., Lin M., Khoshbouei H., Borchelt D.R., Bazick H., Landreth G.E., Lee S., Fazio S. et al. (2019) PMP22 regulates cholesterol trafficking and ABCA1-mediated cholesterol efflux. J. Neurosci., 39, 5404–5418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Feltri M.L., Scherer S.S., Nemni R., Kamholz J., Vogelbacker H., Scott M.O., Canal N., Quaranta V. and Wrabetz L. (1994) Beta 4 integrin expression in myelinating Schwann cells is polarized, developmentally regulated and axonally dependent. Development, 120, 1287–1301. [DOI] [PubMed] [Google Scholar]
  • 37. Nodari A., Previtali S.C., Dati G., Occhi S., Court F.A., Colombelli C., Zambroni D., Dina G., Del Carro U., Campbell K.P. et al. (2008) Alpha6beta4 integrin and dystroglycan cooperate to stabilize the myelin sheath. J. Neurosci., 28, 6714–6719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Srinivasan R., Sun G., Keles S., Jones E.A., Jang S.W., Krueger C., Moran J.J. and Svaren J. (2012) Genome-wide analysis of EGR2/SOX10 binding in myelinating peripheral nerve. Nucleic Acids Res., 40, 6449–6460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Lopez-Anido C., Sun G., Koenning M., Srinivasan R., Hung H.A., Emery B., Keles S. and Svaren J. (2015) Differential SOX10 genomic occupancy in myelinating glia. Glia, 63, 1897–1914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Deng Y., Wu L.M.N., Bai S., Zhao C., Wang H., Wang J., Xu L., Sakabe M., Zhou W., Xin M. et al. (2017) A reciprocal regulatory loop between TAZ/YAP and G-protein Gαs regulates Schwann cell proliferation and myelination. Nat. Commun., 8, 15161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Ma K.H., Hung H.A. and Svaren J. (2016) Epigenomic regulation of Schwann cell reprogramming in peripheral nerve injury. J. Neurosci., 36, 9135–9147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Verdier V., Csárdi G., Preux-Charles A.S., Médard J.J., Smit A.B., Verheijen M.H., Bergmann S. and Chrast R. (2012) Aging of myelinating glial cells predominantly affects lipid metabolism and immune response pathways. Glia, 60, 751–760. [DOI] [PubMed] [Google Scholar]
  • 43. Svaren J. and Meijer D. (2008) The molecular machinery of myelin gene transcription in Schwann cells. Glia, 56, 1541–1551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Jang S.W., Srinivasan R., Jones E.A., Sun G., Keles S., Krueger C., Chang L.W., Nagarajan R. and Svaren J. (2010) Locus-wide identification of Egr2/Krox20 regulatory targets in myelin genes. J. Neurochem., 115, 1409–1420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. He Y., Kim J.Y., Dupree J., Tewari A., Melendez-Vasquez C., Svaren J. and Casaccia P. (2010) Yy1 as a molecular link between neuregulin and transcriptional modulation of peripheral myelination. Nat. Neurosci., 13, 1472–1480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Jones E.A., Lopez-Anido C., Srinivasan R., Krueger C., Chang L.W., Nagarajan R. and Svaren J. (2011) Regulation of the PMP22 gene through an intronic enhancer. J. Neurosci., 31, 4242–4250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. LeBlanc S.E., Srinivasan R., Ferri C., Mager G.M., Gillian-Daniel A.L., Wrabetz L. and Svaren J. (2005) Regulation of cholesterol/lipid biosynthetic genes by Egr2/Krox20 during peripheral nerve myelination. J. Neurochem., 93, 737–748. [DOI] [PubMed] [Google Scholar]
  • 48. Zorick T.S., Syroid D.E., Arroyo E., Scherer S.S. and Lemke G. (1996) The transcription factors SCIP and Krox-20 mark distinct stages and cell fates in Schwann cell differentiation. Mol. Cell. Neurosci., 8, 129–145. [DOI] [PubMed] [Google Scholar]
  • 49. Topilko P., Levi G., Merlo G., Mantero S., Desmarquet C., Mancardi G. and Charnay P. (1997) Differential regulation of the zinc finger genes Krox-20 and Krox-24 (Egr-1) suggests antagonistic roles in Schwann cells. J. Neurosci. Res., 50, 702–712. [DOI] [PubMed] [Google Scholar]
  • 50. Zhao H.T., Damle S., Ikeda-Lee K., Kuntz S., Li J., Mohan A., Kim A., Hung G., Scheideler M.A., Scherer S.S. et al. (2018) PMP22 antisense oligonucleotides reverse Charcot-Marie-Tooth disease type 1A features in rodent models. J. Clin. Invest., 128, 359–368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Tao F., Beecham G.W., Rebelo A.P., Svaren J., Blanton S.H., Moran J.J., Lopez-Anido C., Morrow J.M., Abreu L., Rizzo D. et al. (2019) Variation in SIPA1L2 is correlated with phenotype modification in Charcot-Marie-Tooth disease type 1A. Ann. Neurol., 85, 316–330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Giambonini-Brugnoli G., Buchstaller J., Sommer L., Suter U. and Mantei N. (2005) Distinct disease mechanisms in peripheral neuropathies due to altered peripheral myelin protein 22 gene dosage or a Pmp22 point mutation. Neurobiol. Dis., 18, 656–668. [DOI] [PubMed] [Google Scholar]
  • 53. Sancho S., Magyar J.P., Aguzzi A. and Suter U. (1999) Distal axonopathy in peripheral nerves of PMP22-mutant mice. Brain, 122, 1563–1577. [DOI] [PubMed] [Google Scholar]
  • 54. Yu Y., Chen Y., Kim B., Wang H., Zhao C., He X., Liu L., Liu W., Wu L.M., Mao M. et al. (2013) Olig2 targets chromatin remodelers to enhancers to initiate oligodendrocyte differentiation. Cell, 152, 248–261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Passage E., Norreel J., Noack-Fraissignes P., Sanguedolce V., Pizant J., Thirion X., Robaglia-Schlupp A., Pellissier J. and Fontés M. (2004) Ascorbic acid treatment corrects the phenotype of a mouse model of Charcot-Marie-Tooth disease. Nat. Med., 10, 396–401. [DOI] [PubMed] [Google Scholar]
  • 56. Prukop T., Stenzel J., Wernick S., Kungl T., Mroczek M., Adam J., Ewers D., Nabirotchkin S., Nave K.A., Hajj R. et al. (2019) Early short-term PXT3003 combinational therapy delays disease onset in a transgenic rat model of Charcot-Marie-Tooth disease 1A (CMT1A). PLoS One, 14, e0209752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Pareyson D., Reilly M.M., Schenone A., Fabrizi G.M., Cavallaro T., Santoro L., Vita G., Quattrone A., Padua L., Gemignani F. et al. (2011) Ascorbic acid in Charcot-Marie-Tooth disease type 1A (CMT-TRIAAL and CMT-TRAUK): a double-blind randomised trial. Lancet Neurol., 10, 320–328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Attarian S., Vallat J.M., Magy L., Funalot B., Gonnaud P.M., Lacour A., Péréon Y., Dubourg O., Pouget J., Micallef J. et al. (2014) An exploratory randomised double-blind and placebo-controlled phase 2 study of a combination of baclofen, naltrexone and sorbitol (PXT3003) in patients with Charcot-Marie-Tooth disease type 1A. Orphanet J. Rare Dis., 9, 199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Li J. (2017) Caveats in the established understanding of CMT1A. Ann. Clin. Transl. Neurol., 4, 601–607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Svaren J., Moran J.J., Wu X., Zuccarino R., Bacon C., Bai Y., Ramesh R., Gutmann L., Anderson D.M., Pavelec D. et al. (2019) Schwann cell transcript biomarkers for hereditary neuropathy skin biopsies. Ann. Neurol., 85, 887–898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Livak K.J. and Schmittgen T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods, 25, 402–408. [DOI] [PubMed] [Google Scholar]
  • 62. Zhang X., Chow C.Y., Sahenk Z., Shy M.E., Meisler M.H. and Li J. (2008) Mutation of FIG4 causes a rapidly progressive, asymmetric neuronal degeneration. Brain, 131, 1990–2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Moiseev D., Hu B. and Li J. (2019) Morphometric analysis of peripheral myelinated nerve fibers through deep learning. J. Peripher. Nerv. Syst., 24, 87–93. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Human Molecular Genetics are provided here courtesy of Oxford University Press

RESOURCES