Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 May 21.
Published in final edited form as: Biochem Biophys Res Commun. 2020 Mar 17;526(1):21–28. doi: 10.1016/j.bbrc.2020.03.025

Divergent Effects of Myogenic Differentiation and Diabetes on the Capacity for Muscle Precursor Cell Adipogenic Differentiation in a Fibrin Matrix

Francisca M Acosta 1,2, U-Ter Aonda Jia 1,2, Katerina Stojkova 1, Settimio Pacelli 1, Eric M Brey 1, Christopher Rathbone 1,*
PMCID: PMC7328770  NIHMSID: NIHMS1577150  PMID: 32192775

Abstract

The development of ectopic adipose tissue in skeletal muscle is associated with several skeletal muscle and metabolic pathologies, including Type II Diabetes Mellitus. The adipogenic differentiation of muscle precursor cells (MPCs) has been postulated to occur in skeletal muscle in vivo in a three-dimensional (3-D) configuration; therefore, it is appropriate to investigate this phenomenon using 3-D matrices in vitro. The capacity for MPC adipogenic differentiation in a 3-D environment was investigated in fibrin hydrogels by treating MPCs derived from healthy or diabetic animals with adipogenic induction medias that differed in their ability to increase lipid accumulation and activate the expression of genes associated with adipogenic differentiation (peroxisome proliferator-activated receptor gamma (PPARG), adiponectin (ADIPOQ), and fatty acid synthase (FAS)). The capacity for adipogenic differentiation was diminished, but not prevented, if myogenic differentiation preceded MPC exposure to adipogenic induction conditions. Conversely, adipogenic differentiation was greater in hydrogels containing MPCs from diabetic rats as compared to those derived from lean rats, as evidenced by an increase in lipid accumulation and adipogenic gene expression. Collectively, the data herein support a role for the MPCs in adipogenesis in a 3-D environment and that they may contribute to the ectopic accumulation of adipose tissue. The observation that the potential for adipogenic differentiation is maintained even after a period of myogenic differentiation alludes to the possibility that adipogenesis may occur during different phases of muscle development. Finally, the increase in adipogenic differentiation in hydrogels containing MPCs derived from diabetic animals provides strong evidence that a pathological environment in vivo increases their capacity for adipogenesis.

Keywords: satellite cells, skeletal muscle, adipogenesis, myogenesis, three-dimensional, fibrin

Graphical Abstract

graphic file with name nihms-1577150-f0005.jpg

1. Introduction

An increase in adipocytes and the presence of ectopic adipose tissue within and between skeletal muscle fibers is associated with many adverse outcomes associated with disease, which include lipid accumulation, insulin resistance, and mitochondrial dysfunction [1–3]. The identification of the cells and mechanisms responsible for the appearance of this pathological state have not been fully resolved; however, a variety of muscle resident cells with adipogenic potential have been implicated [4–6]. Of these, the resident progenitor cells located between the basal lamina and plasmalemma within muscle fibers known as satellite cells, and their progeny (often referred to as muscle precursor cells, myogenic progenitor cells, or muscle progenitor cells (MPCs)) are uniquely situated to play a role in the progression of ectopic lipid deposition. When cultured under adipogenic conditions and/or derived from diabetic animals they exhibit an increase in lipid storage and adipogenic gene expression [6–10].

The majority of the evidence supporting a role for muscle-derived cells (which include MPCs) in the development of adipose tissue in diseased skeletal muscle has been acquired from traditional two-dimensional culture studies, and less frequently, co-culture systems to investigate the cross-talk between adipocytes and muscle cells [6–14]. Whether or not MPC adipogenic differentiation is maintained in a three-dimensional (3-D) configuration has received relatively little attention. This is an important distinction because 3-D cultures better mimic the spatial organization of MPC in skeletal muscle by providing a more physiologically relevant model in vitro to study adipocytes accumulation in skeletal muscle. For instance, culturing MPC within biocompatible polymeric soft hydrogels, which can be designed to more closely approximate the matrix elasticity of soft tissues where ectopic lipid deposition occurs, may provide a more suitable biomimetic microenvironment compared to a relatively hard tissue culture dish when investigating adipogenic differentiation [15].

In the current study, the potential for the MPC adipogenic differentiation in fibrin hydrogels was evaluated by determining: (1) the effect of adipogenic induction medias that differed in their ability to affect adipogenic gene expression, (2) the effect of inducing myogenic differentiation prior to adipogenic induction, and (3) whether MPCs derived from diabetic animals have an increased adipogenic potential. Collectively, the findings herein suggest that in vitro 3-D cultures are appropriate for evaluating ectopic adipocyte accumulation in skeletal muscle and support the contention that MPCs in diabetic muscles contribute to the progression of this pathology.

2. Materials and Methods

2.1. Animals

Experiments were carried out using cells isolated from 8 to 12-month-old male Lewis rats (Envigo, Indianapolis, IN), or lean (FA/+) male Zucker diabetic fatty (ZDF) or obese (FA/FA) rats (Charles River, Wilmington, MA). ZDF rats were obtained at 4 weeks of age and fed Purina 5008 until 15 weeks of age. FA/FA rats had a non-fasting blood glucose level higher than 300 mg/dL (385 +/− 32 mg/dL) on the day of euthanasia. All animals were housed in a temperature-controlled environment with a 12-h light-dark cycle and fed ad libitum. This study was conducted in compliance with the Animal Welfare Act and the Implementing Animal Welfare Regulations, in accordance with the principles of the Guide for the Care and Use of Laboratory Animals, and was approved by the Institutional Animal Care and Use Committee at the University of Texas at San Antonio.

2.2. Muscle precursor cell isolation and fibrin gel construction

Rat muscle precursor cells (MPCs) were isolated from tibialis anterior, extensor digitorum longus, quadriceps, gastrocnemius, plantaris, and soleus muscles, following a protocol similar to that reported by Lees et al. [16]. MPCs were cultured in growth medium (GM) composed of 20% fetal bovine serum (FBS), 1% penicillin-streptomycin (P/S), 0.2% MycoZap, and Dulbecco’s Modified Eagle Medium (DMEM) containing 1 g/L D-glucose, L-glutamine, and 110 mg/L sodium pyruvate until ~80% confluency before passaging, with passage 2 or 3 cells being used for all experiments. MPCs (1.25×106 cells/mL) were suspended in fibrinogen solubilized in DMEM at a concentration of 20 mg/mL. The cell suspension in fibrinogen was mixed with 10U/mL of thrombin to form fibrin gels with a final concentration of 5.7 mg/mL to create 3-D constructs in individual wells of 96-well plates. All media for 3-D constructs was supplemented with 1mg/mL aminocaproic acid to inhibit fibrinolysis.

2.3. Myogenic Differentiation and Adipogenic Induction

Hydrogels containing MPCs treated with myogenic media (MM) were first cultured in GM for 4 days before being switched to myogenic differentiation media (2% horse serum, 1% P/S, 0.2% MZ, and DMEM) for an additional 10 or 24 days. Adipogenic differentiation was induced by using two different types of media treatments: (1) Adipose induction media that consisted of DMEM/F12, 20% FBS, 1% P/S, 0.2% MZ, 10 μg/ml Insulin, 10 μM Forskolin and 1 μM Dexamethasone for 4 days, followed by maturation media containing DMEM/F12, 20% FBS, 1% P/S, 0.2% MZ and 10μg/ml Insulin for 10 or 14 days; (referred to as AM) or (2) Adipose induction media that was supplemented with 0.5μM Rosiglitazone (Rosi), and 1nM Triiodothyronine (T3), followed by a maturation media that consisted of AM maturation media supplemented with 1μM Rosi, and 1nM T3 for an additional 10 or 24 days (referred to as AM+). The two different media formulations were chosen with AM containing standard components for adipogenic induction (insulin and dexamethasone) [17] with the addition of forskolin, a cAMP activator [18]. AM+ was also supplemented with T3 and Rosiglitazone to be consistent with previous experiments where the adipogenic differentiation of MPCs was investigated [6, 8]. For experiments where myogenic differentiation preceded adipogenic differentiation, hydrogels were first cultured in GM for 4 days, myogenic differentiation media for 10 days, and then cultured in AM or AM+ induction media and maturation media for 4 and 10 days, respectively (MM/AM or MM/AM+). See figures 1A, 2A, and 3A for a schematic detailing the timing of media treatment for the individual experiments.

Figure 1.

Figure 1.

Open in a new tab

Evaluation of the adipogenic differentiation of muscle precursor cells (MPCs) treated with different adipogenic differentiation medias. A) Schematic describing the study and showing the different groups tested. B) Representative confocal images of satellite cells grown in fibrin hydrogels (plugs) and stained with actin (red) to visualize cell morphology and BODIPY (green) to identify the presence of lipid droplets. The images on the top (scale bars = 1 mm) display an overview of the distribution of the MPCs in the hydrogel, and the corresponding insets on the bottom were included to visualize more clearly the presence of adipocytes (scale bars = 200 μm). C) Quantification of mean fluorescence intensity of BODIPY staining from confocal images. Results are reported as mean ± standard error (n = 4). qPCR analysis of main adipogenic and myogenic genes after 14 days of culture. D-F) Fold expression of several adipogenic genes, including peroxisome proliferator-activated receptor gamma (PPARG), Adiponectin (ADIPOQ), and Fatty acid synthase (FAS). G-I) Myogenic gene expression of, including myoblast determination protein 1 (MyoD), myogenin (MYOG), and Myosin heavy chain (MHC). Results are normalized based on the fold expression of the control group where muscle precursor cells where cultured in myogenic differentiation media (MM). AM; adipogenic differentiation media, AM+; adipogenic differentiation media supplemented with triiodothyronine and rosiglitazone. Results are reported as mean ± standard error (n=4). The presence of different letters represents statistical significance among the groups (p < 0.05). Bars displaying the same letter indicate no statistical significance among the groups (n.s.).

Figure 2.

Figure 2.

Open in a new tab

Evaluation of the effect of myogenic differentiation on adipogenic differentiation. A) Schematic describing the study and the different groups tested. B) Representative confocal images of MPCs grown in fibrin hydrogels (plugs) and stained with actin (red) to visualize cell morphology and BODIPY (green) to identify the presence of lipid droplets. The images on the top represented the whole hydrogel (scale bars = 1 mm) and the image of the bottom were included to visualize the presence of lipid droplets (scale bars = 200 μm). C) Quantification of mean fluorescence intensity of BODIPY staining from confocal images. AM; adipogenic differentiation media, AM+; adipogenic differentiation media supplemented with triiodothyronine and rosiglitazone. Results are reported as mean ± standard error (n = 4). qPCR analysis of main adipogenic and myogenic genes after 28 days of culture D-F) Fold expression of several adipogenic genes, including peroxisome proliferator-activated receptor gamma (PPARG), Adiponectin (ADIPOQ), and Fatty acid synthase (FAS). G-I) Fold expression of several myogenic markers, including myoblast determination protein 1 (MyoD), myogenin (MYOG), and Myosin heavy chain (MHC). Results are reported as mean ± standard error (n=4). The presence of different letters represents statistical significance among the groups (p < 0.05). Bars displaying the same letter indicate no statistical significance among the groups (n.s.).

Figure 3.

Figure 3.

Open in a new tab

Adipogenic differentiation of muscle precursor cells (MPCs) isolated from lean and diabetic rats. A) Schematic showing the study and the different groups tested. B) Representative confocal images of MPCs grown in fibrin hydrogels (plugs) and stained with actin (red) to visualize cell morphology and BODIPY (green) to identify the presence of lipid droplets. The images on the top (scale bars = 1 mm) display an overview of the distribution of the satellite cells in the hydrogel, and the corresponding insets on the bottom were included to visualize more clearly the presence of adipocytes (scale bars = 200 μm). C) Quantification of mean fluorescence intensity of BODIPY staining from confocal images. AM; adipogenic differentiation media, AM+; adipogenic differentiation media supplemented with triiodothyronine and rosiglitazone. Results are reported as mean ± standard error (n = 6). The presence of different letters represents statistical significance among the groups (p < 0.05). Bars displaying the same letter indicate no statistical significance among the groups (n.s.).

2.4. Histological Analysis

Hydrogels were fixed in 4% formaldehyde for 2 hours at room temperature, permeabilized using 0.5% Triton-X for 20 minutes, then stained using boron-dipyrromethene (BODIPY; ThermoFisher, D3922, 1:100), F-Actin (ThermoFisher, R37112), and DAPI (ThermoFisher, R37606). Whole gels (n = x/group/experiment) were imaged on a Leica TCS SP8 Confocal Microscope (Buffalo Grove, IL) with a rendering of 100μm thickness/10μm sections of the entire well coverage area. Quantification was performed using the Leica 3D analysis toolkit using Otsu thresholding.

2.5. Gene Expression Analysis

RNA was isolated and purified using a Qiagen RNeasy Mini Kit (Valencia, CA) according to manufacturer guidelines (n=4 /group). mRNA concentrations were measured using a Take3 Micro-Volume Plate (BioTek, Winooski, VT) and normalized to 150 ng of mRNA for its conversion to cDNA using the iScript cDNA synthesis kit (BioRad, Hercules, CA). Real-time quantitative polymerase chain reaction (qPCR) was performed using 10 μL of iTaq Universal SYBR Green Supermix (BioRad, Hercules, CA) in a CFX96 Touch Real-Time PCR Detection System (BioRad, Hercules, CA). All primers used to carry out the qPCR analysis were predesigned primers (Sigma-Aldrich; St. Louis, Mo) listed in table 1. Fold expression levels were calculated using the 2-ΔΔCt method, where the GM gels at day 1 were designated as the calibrator group and GAPDH expression was used as the endogenous control [19].

TABLE 1.

PCR Primers

Target Gene Sequence (5’−3’)
rGAPDH F – AGCCCAGAACACCATTCCTAC
R – ATGCCTGCTTCACCACATTC
rMyoD F – GCGACACGCGATGACTTCTAT
R – GGTCCAGGTCCTCAAAAAAGC
rMyoG F – GACCCTACAGGTGCCCACAA
R – ACATATCCTCCACCGTGATGCT
reMHC F – TGGAGGACCAAATATGAGACG
R – CACCATCAAGTCCTCCACCT
rPPARG F – ACCCAGAGCATGGTGCCTTCG
R – TGGTGGGCCAGAATGGCATCTCT
rAdiponectin F – GTTGGATGGCAGGCATCC
R – GCTCTCCTTTCCTGCCAG
rFAS F – GCCCTGCTACCACTGAAGAG
R – GTTGTAATCGGCACCCAAGT
Open in a new tab

Abbreviations:r, Rat; e, Embryonic; F, forward primer; R, reverse primer

2.6. Statistical Analysis

Graphpad Prism Software 6 (GraphPad Software, Inc., La Jolla, CA) was used to run one-way analysis of variance (ANOVA) tests with Tukey’s multiple comparison analyses to determine differences between groups. Statistical significance was determined when p < 0.05. All results are presented as mean ± standard error of the mean (SEM).

3. Results

3.1. Evaluation of the effect of adipogenic media on MPC differentiation.

In accordance with previous results in 2-D studies [6–8, 10], the treatment of MPCs in both adipogenic conditions (AM and AM+) increased lipid deposition as compared to control cultures (myogenic media only) when cultured in 3D hydrogels, with AM+ treatment causing an almost 2-fold increase in lipid accumulation as compared to AM (Figure 1B, 1C). Furthermore, increases in lipid deposition with AM+ treatment was associated with increases in the expression of adipogenic genes, including PPARG (~ 26-fold), ADIPOQ (~2034 fold) and FAS (~31 fold), however, adipogenic gene expression was not significantly different between AM and control treatments (Figure 1C–1E). Similarly, AM+ treatment was associated with increases in the expression of myogenic genes, including MyoD (~9 fold), Myogenin (~11 fold), and MHC (~5 fold), however, myogenic gene expression was not significantly different between AM and control treatments.

3.2. Effect of myogenic differentiation on adipogenic differentiation.

The salient finding of this set of experiments is that MPC differentiation did not prevent adipogenic differentiation (MM/AM+ vs MM), however, it reduced adipogenic differentiation ~ 2-fold (AM+ vs MM/AM+) (Figure 2B). Similar to the first set of experiments that were carried out over 14 days, 28 days of AM+ treatment again resulted in the highest level of lipid deposition (Figures 2B and 2C). Although there was a higher level of lipid deposition when comparing AM+ to AM after 14 days of treatment, adipogenic media (both AM and AM+) increased the expression of PPARG and ADIPOQ as compared to control cultures (MM only). This increment was observed regardless of whether or not myogenic differentiation had already occurred, but did not have a significant effect on FAS expression (Figures 2 D-F). The trend of PPARG expression was most closely associated with changes in lipid deposition, with the highest levels being observed with AM+ treatment which was reduced with prior myogenic differentiation (MM/AM+), and a higher expression when comparing MM/AM+ to MM/AM (Figures 2 D-F). Changes in myogenic gene expression among groups were not statistically significant except for MHC which was higher in the MM/AM treatment group.

3.3. Assessment of adipogenic differentiation between MPCs derived from lean or diabetic skeletal muscle tissue.

Consistent with the first set of experiments, both lean and diabetic MPCs responded to AM treatment with an increase in lipid deposition as compared to control, with even further increases being realized with AM+ treatment (Figure 3B). The most critical observation of this set of experiments was that diabetic MPCs exhibited higher levels of lipid deposition as compared to healthy MPCs regardless of whether they were treated with either AM or AM+ media, suggesting diabetic MPCs have a greater capacity for adipogenic differentiation, an observation demonstrated previously in 2-D culture [8]. The trend for adipogenic gene expression was similar to that observed in the first sets of experiments; AM significantly increased the expression of adipogenic genes with further increases observed with AM+ treatment (Figure 4 A-C). PPARG, ADIPOQ, and FAS gene expression was higher in diabetic than lean MPCs when treated with AM+, and ADIPOQ gene expression was higher for diabetic than lean MPCs when treated with AM. No significant difference could be detected among the groups tested for myogenic genes, except for MyoG expression, which resulted higher in the diabetic AM+ group (Figure 4E).

Figure 4.

Figure 4.

Open in a new tab

qPCR analysis of main adipogenic and myogenic genes of muscle precursor cells (MPCs) extracted from lean and diabetic rats after 14 days of culture. A-C) Fold expression of several adipogenic genes, including peroxisome proliferator-activated receptor gamma (PPARG), Adiponectin (ADIPOQ), and Fatty acid synthase (FAS). D-F) Fold expression of several myogenic markers, including myoblast determination protein 1 (MyoD), myogenin (MYOG), and Myosin heavy chain (MHC). Results are normalized based on the fold expression of the control group where MPCs where cultured in myogenic media (MM). AM; adipogenic differentiation media, AM+; adipogenic differentiation media supplemented with triiodothyronine and rosiglitazone. Results are reported as mean ± standard error (n=4). The presence of different letters represents statistical significance among the groups (p < 0.05). Bars displaying the same letter indicate no statistical significance among the groups (n.s.).

4. Discussion.

Understanding the biological cues responsible for adipose tissue accumulation into skeletal muscle may help inform the development of therapies to treat a variety of skeletal muscle disorders, to include diabetes. [7]. In the current study, the potential for MPC adipogenic differentiation was evaluated in a 3-D in vitro model based on the premise that the 3-D culture of muscle cells is has important effects on differentiation, and is more physiologically relevant than conventional 2-D culture methods [20]. Overall, the capacity for MPC adipogenic differentiation in 3-D culture was observed across three different experiments using different levels of adipogenic induction (AM vs AM+), time courses for analyses (14 or 28 days), source of MPCs (healthy vs diabetic), and myogenic state (proliferating vs differentiated).

The utilization of different types of adipogenic induction media provided insight with regards to the capacity for MPC adipogenic differentiation in 3-D culture. More specifically, the differences in lipid deposition and adipogenic gene expression between AM and AM+ treatment suggests that MPC adipogenic differentiation is not an all-or-none event and occurs across a continuum of molecular signaling. Adipogenic differentiation was stimulated at two different levels, both media types (AM and AM+) contained insulin, dexamethasone, and forskolin, however, a more potent adipogenic stimulation was achieved with the addition of T3 and Rosiglitazone in AM+ media [6]. Rosiglitazone is known to induce the activation of the nuclear PPARG receptor, which is the primary regulator of adipocyte differentiation [21]. Additionally, PPARG activation is also involved in the regulation of muscle fat infiltration during muscle regeneration [22]. Interestingly, MPC cultured in AM+ also displayed an increased expression of myogenic markers after 14 days of culture (Figures 1G, 1H, 1I). This effect could be partially explained by the presence in the adipogenic media of hormones such as triiodothyronine (T3), which has been found to promote the activation of the MyoD gene in myogenic cell lines [23].

It is also important to consider the capacity of myogenic cells for adipogenic differentiation in the context of different phases of myogenic maturation. A well-observed phenomenon of MPCs is their ability to undergo events in vitro that resemble their contribution to muscle repair in vivo. In vitro, isolated MPCs undergo stages of activation, proliferation, and differentiation to form myotubes; after injury satellilte cells are activated, proliferate, and then fuse with themselves or other fibers to replenish myonuclei. The initiation of the treatment of MPC cultures with AM or AM+ occurred during the proliferative phase at a time when all cells are presumably available for multi-differentiation. In contrast, it’s plausible to speculate that once MPC are committed towards a myogenic lineage, they are less likely to be transdifferentiated into adipocytes. In the current study, a diminished capacity for pre-differentiated MPC to undergo adipogenesis within the fibrin matrix was observed (Figure 2). Additionally, the expression of the tested adipogenic markers was lower in pre-differentiated MPC compared to the group treated with AM+ media only (Figure 2 D-F). Similar results have been reported in a different study investigating the adipogenic differentiation of human satellite cells in 2D culture [6]. This effect could likely be ascribed to the activation of the WNT signaling pathway, which regulates the initiation of myogenesis [24] and is responsible for the inhibition of adipogenic differentiation simultaneously [25]. Collectively, it’s reasonable to speculate that even after prior myogenic differentiation, precursor cells with adipogenic potential reside within myotubes that retain adipogenic potential.

The 3-D model was also used to evaluate possible differences in the adipogenic potential between MPCs derived from skeletal muscle tissue harvested from lean and diabetic Zucker rats. An increased lipid droplet deposition and expression of adipogenic markers were found in the diabetic groups treated with AM+ media at 14 days of culture (Figure 3 B-C and Figure 4 A-C). Similar findings were reported when investigating the adipogenic differentiation of satellite cells harvested from obese and lean SCs cultured in 2-D [8]. The enhanced adipogenic potential observed for SCs from obese Zucker rats could be attributed to the downregulation of Wnt10b gene, which is involved in the regulation of myogenesis [25].

The most noteworthy observations from the findings herein are that myogenic differentiation inhibited, but did not prevent adipogenic differentiation, and that MPCs derived from diabetic animals exhibited an increased potential for adipogenic differentiation. The significance of the overall findings is underscored by the fact that these phenomena occurred in 3-D culture. Collectively, these observations provide critical details to help support the development of therapies to offset the negative consequences of ectopic adipose tissue formation that occurs in diseased skeletal muscle.

  • Muscle cell adipogenic differentiation extent in 3-D depends on culture conditions

  • Pre-differentiation inhibits muscle cell adipogenic potential in 3-D

  • Diabetes augments capacity for muscle cell adipogenesis in 3-D

5. Acknowledgements

This work was supported, in part, by the National Institutes of Health (SC1DK122578, 5R01EB020604), Veterans Administration (5 I01 BX000418–06), the University of Texas System Science and Technology Acquisition and Retention Program, the University of Texas at San Antonio Department of Biomedical Engineering, and the UTSA RISE Research Training Program (NIH GM060655).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

6. References

  • [1].Goodpaster BH, Thaete FL, Kelley DE, Thigh adipose tissue distribution is associated with insulin resistance in obesity and in type 2 diabetes mellitus, The American journal of clinical nutrition, 71 (2000) 885–892. [DOI] [PubMed] [Google Scholar]
  • [2].Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman DL, DiPietro L, Cline GW, Shulman GI, Mitochondrial dysfunction in the elderly: possible role in insulin resistance, Science, 300 (2003) 1140–1142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Vettor R, Milan G, Franzin C, Sanna M, De Coppi P, Rizzuto R, Federspil G, The origin of intermuscular adipose tissue and its pathophysiological implications, American journal of physiology. Endocrinology and metabolism, 297 (2009) E987–998. [DOI] [PubMed] [Google Scholar]
  • [4].Uezumi A, Fukada S, Yamamoto N, Takeda S, Tsuchida K, Mesenchymal progenitors distinct from satellite cells contribute to ectopic fat cell formation in skeletal muscle, Nat Cell Biol, 12 (2010) 143–152. [DOI] [PubMed] [Google Scholar]
  • [5].Natarajan A, Lemos DR, Rossi FM, Fibro/adipogenic progenitors: a double-edged sword in skeletal muscle regeneration, Cell Cycle, 9 (2010) 2045–2046. [DOI] [PubMed] [Google Scholar]
  • [6].De Coppi P, Milan G, Scarda A, Boldrin L, Centobene C, Piccoli M, Pozzobon M, Pilon C, Pagano C, Gamba P, Vettor R, Rosiglitazone modifies the adipogenic potential of human muscle satellite cells, Diabetologia, 49 (2006) 1962–1973. [DOI] [PubMed] [Google Scholar]
  • [7].Yada E, Yamanouchi K, Nishihara M, Adipogenic potential of satellite cells from distinct skeletal muscle origins in the rat, The Journal of veterinary medical science, 68 (2006) 479–486. [DOI] [PubMed] [Google Scholar]
  • [8].Scarda A, Franzin C, Milan G, Sanna M, Dal Pra C, Pagano C, Boldrin L, Piccoli M, Trevellin E, Granzotto M, Gamba P, Federspil G, De Coppi P, Vettor R, Increased adipogenic conversion of muscle satellite cells in obese Zucker rats, Int J Obes (Lond), 34 (2010) 1319–1327. [DOI] [PubMed] [Google Scholar]
  • [9].Shefer G, Wleklinski-Lee M, Yablonka-Reuveni Z, Skeletal muscle satellite cells can spontaneously enter an alternative mesenchymal pathway, Journal of cell science, 117 (2004) 5393–5404. [DOI] [PubMed] [Google Scholar]
  • [10].Asakura A, Komaki M, Rudnicki M, Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation, Differentiation; research in biological diversity, 68 (2001) 245–253. [DOI] [PubMed] [Google Scholar]
  • [11].Dietze D, Koenen M, Rohrig K, Horikoshi H, Hauner H, Eckel J, Impairment of insulin signaling in human skeletal muscle cells by co-culture with human adipocytes, Diabetes, 51 (2002) 2369–2376. [DOI] [PubMed] [Google Scholar]
  • [12].Kovalik JP, Slentz D, Stevens RD, Kraus WE, Houmard JA, Nicoll JB, Lea-Currie YR, Everingham K, Kien CL, Buehrer BM, Muoio DM, Metabolic remodeling of human skeletal myocytes by cocultured adipocytes depends on the lipolytic state of the system, Diabetes, 60 (2011) 1882–1893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Pellegrinelli V, Rouault C, Rodriguez-Cuenca S, Albert V, Edom-Vovard F, Vidal-Puig A, Clément K, Butler-Browne GS, Lacasa D, Human Adipocytes Induce Inflammation and Atrophy in Muscle Cells During Obesity, Diabetes, 64 (2015) 3121–3134. [DOI] [PubMed] [Google Scholar]
  • [14].Takegahara Y, Yamanouchi K, Nakamura K, Nakano S, Nishihara M, Myotube formation is affected by adipogenic lineage cells in a cell-to-cell contact-independent manner, Experimental cell research, 324 (2014) 105–114. [DOI] [PubMed] [Google Scholar]
  • [15].Young DA, Choi YS, Engler AJ, Christman KL, Stimulation of adipogenesis of adult adipose-derived stem cells using substrates that mimic the stiffness of adipose tissue, Biomaterials, 34 (2013) 8581–8588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Lees SJ, Rathbone CR, Booth FW, Age-associated decrease in muscle precursor cell differentiation, Am J Physiol Cell Physiol, 290 (2006) C609–615. [DOI] [PubMed] [Google Scholar]
  • [17].Scott MA, Nguyen VT, Levi B, James AW, Current methods of adipogenic differentiation of mesenchymal stem cells, Stem Cells Dev, 20 (2011) 1793–1804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Takeda Y, Harada Y, Yoshikawa T, Dai P, Direct conversion of human fibroblasts to brown adipocytes by small chemical compounds, Sci Rep, 7 (2017) 4304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Livak KJ, Schmittgen TD, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods, 25 (2001) 402–408. [DOI] [PubMed] [Google Scholar]
  • [20].Grabowska I, Szeliga A, Moraczewski J, Czaplicka I, Brzoska E, Comparison of satellite cell-derived myoblasts and C2C12 differentiation in two- and three-dimensional cultures: changes in adhesion protein expression, Cell biology international, 35 (2011) 125–133. [DOI] [PubMed] [Google Scholar]
  • [21].Berger J, Moller DE, The mechanisms of action of PPARs, Annual review of medicine, 53 (2002) 409–435. [DOI] [PubMed] [Google Scholar]
  • [22].Dammone G, Karaz S, Lukjanenko L, Winkler C, Sizzano F, Jacot G, Migliavacca E, Palini A, Desvergne B, Gilardi F, Feige JN, PPARgamma Controls Ectopic Adipogenesis and Cross-Talks with Myogenesis During Skeletal Muscle Regeneration, International journal of molecular sciences, 19 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Muscat GE, Mynett-Johnson L, Dowhan D, Downes M, Griggs R, Activation of myoD gene transcription by 3,5,3’-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors, Nucleic acids research, 22 (1994) 583–591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Ridgeway AG, Petropoulos H, Wilton S, Skerjanc IS, Wnt signaling regulates the function of MyoD and myogenin, J Biol Chem, 275 (2000) 32398–32405. [DOI] [PubMed] [Google Scholar]
  • [25].Vertino AM, Taylor-Jones JM, Longo KA, Bearden ED, Lane TF, McGehee RE Jr., MacDougald OA, Peterson CA, Wnt10b deficiency promotes coexpression of myogenic and adipogenic programs in myoblasts, Molecular biology of the cell, 16 (2005) 2039–2048. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES