Table 2.
Validation of cleavage events on TF cDNAs in published degradome sequencing data.
| TFF | mRNA ID | TS on cDNA | CS on cDNA | Sequencing tags (cleavage site / whole cDNA) | Nucleotide composition | |||
|---|---|---|---|---|---|---|---|---|
| 5 DPA | MG | Br | RR | |||||
| AP2 | Solyc02g093150.3.1 | 1,560–1,580 | 1572 | 170/83 | 133/379 | 109/211 | 23/71 | GCTGCTGCAGCATCATCAGGATTCCCTCA |
| Solyc03g044300.3.1 | 1,366–1,386 | 1,384 | 127/267 | 164/364 | 3,353/5,359 | 465/1582 | ACTGCTGCAGCATCATCAGGATTCCCCCA | |
| Solyc02g064960.3.1 | 1764–1784 | 1744 | 170/304 | 133/165 | 109/300 | 23/77 | ACTGCTGCAGCATCATCAGGATTCCCTCA | |
| Solyc06g075510.3.1 | 1,348–1,368 | 1522 | 146/233 | 23/86 | 3/5 | 1/5 | TGCACGGCAGCATCATCAGGATTCTTCAT | |
| Solyc09g007260.3.1 | 1624–1644 | 1523 | 81/337 | 8/40 | –/– | 1/4 | TCTACTGCAGCATCATCAGGATTCGCTAA | |
| Solyc10g084340.2.1 | 2,182–2,202 | 1,252 | 164/210 | 13/22 | 1/8 | 0/3 | TCTACTGCAGCATCATCAGGATTCGGAAA | |
| SBP | Solyc07g062980.3.1 | 443–462 | 448 | –/– | 1/6 | –/– | –/– | TGAAATGCTTACTCTCTTCTGTCAGCCC |
| Solyc05g015510.3.1 | 2,555–2,574 | 2,962 | 3/520 | 50/895 | 55/633 | 38/652 | CCTCGTGCTCTCTCTCTTCTGTCAACTA | |
| Solyc05g015840.3.1 | 900–919 | 760 | 1/39 | 1/18 | –/– | –/– | GATCGTGCTCTCTCTCTTCTGTCATCAG | |
| Solyc10g078700.2.1 | 3,614–3,633 | 775 | 24/660 | 51/117 | 1/7 | 1/4 | AGTGGTGCTCTCTCTCTTCTGTCAAATC | |
| Solyc12g038520.2.1 | 1,431–1,450 | 981 | 3/69 | 12/41 | 1/10 | 4/8 | GGCTGTGCTCTCTCTCTTCTGTCATCTC | |
| ARF | Solyc11g069500.2.1 | 1836–1857 | 1,313 | 17/433 | 42/634 | 145/524 | 10/307 | ACTGCAGGCATACAGGGAGCCAGGCATGCT |
Degradome sequencing data64 for TF (TF, column 1) mRNAs (column 2) predicted to be regulated by miRNAs (column 3: target site (TS); eITAG3.2) were analyzed. For each mRNA the cleavage site (column 4—CS; ITAG2.3) and sequencing tag information is indicated64. Sequencing tag information includes the number of tags at the crosslink position and on the whole cDNA for four stages of tomato fruit development (5 days post-anthesis (5 DPA), mature green (MG), breaker (Br) and red ripe (RR)). In the last column the nucleotide composition in the target site region is shown, whereby large letters indicate the target site region and bold letters the identified cleavage site64. Differences between target and cleavage site positions are due to differences in the annotation releases (eITAG3.2 and ITAG2.3).