KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| mouse anti-DDX3X (western; 1:100) | Santa Cruz Biotechnology | Cat# sc-365768, RRID:AB_10844621 |
| mouse anti-Tubulin (western; 1:1000) | Sigma-Aldrich | Cat# T6199, RRID:AB_477583 |
| rabbit polyclonal anti-DDX3 (custom made using peptide ENALGLDQQFAGLDLNSSDNQS) | Genemed Synthesis (custom made) / Stephen Floor lab | N/A |
| rabbit anti-DDX3X (IF; 1:150) | Protein Tech | Cat# 11115–1-AP, RRID:AB_10896499 |
| rabbit anti-DDX3X (IF; 1:500) | Sigma-Aldrich | Cat# HPA001648, RRID:AB_1078635 |
| mouse anti-TUJ1 (IF; 1:1000) | Biolegend | Cat# 801202, RRID:AB_10063408 |
| mouse anti-NESTIN (IF; 1:100) | BD Biosciences | BD401 |
| rabbit anti-PAX6 (IF; 1:1000) | Millipore | Cat# AB2237, RRID:AB_1587367 |
| rabbit anti-TBR2 (IF; 1:1000) | Abcam | Cat# ab23345, RRID:AB_778267 |
| rabbit anti-CC3 (IF; 1:250) | Cell Signaling Technology | Cat# 9661, RRID:AB_2341188 |
| rabbit anti-NEUROD2 (IF; 1:500) | Abcam | Cat# ab104430, RRID:AB_10975628 |
| chicken anti-GFP (IF; 1:1000) | Abcam | Cat# ab13970, RRID:AB_300798 |
| rabbit anti-Laminin (IF; 1:200) | Millipore | Cat# AB2034, RRID:AB_91209 |
| rabbit anti-acetylated Tubulin (IF; 1:500) | Sigma-Aldrich | Cat# T7451, RRID:AB_609894 |
| rabbit anti-FMRP (IF; 1:500) | Sigma-Aldrich | Cat# F1804, RRID:AB_262044 |
| mouse anti-TIA1 (IF; 1:100) | Abcam | Cat# ab2712, RRID:AB_2201439 |
| mouse anti-puromycin (IF; 1:100) | DSHB | Cat# PMY-2A4, RRID:AB_2619605 |
| anti-RFP (IF; 1:500) | Rockland | Cat# 600-401-379S, RRID:AB_11182807 |
| guinea pig anti-NeuN (IF; 1:1000) | Merck | Cat# ABN90P, RRID:AB_2341095 |
| chicken anti-GFAP (IF; 1:1000) | Abcam | Cat# ab4674, RRID:AB_304558 |
| goat anti-OLIG2 (IF; 1:200) | Santa Cruz Biotechnology | Cat# sc-19969, RRID:AB_2236477 |
| goat anti-IBA1 (IF; 1:1000) | Abcam | Cat# ab5076, RRID:AB_2224402 |
| mouse anti-FOXJ1 (IF; 1:1000) | Thermo Fisher Scientific / eBioscience | Cat# 14-9965-82, RRID:AB_1548835 |
| Bacterial and Virus Strains | ||
| NEB 5-alpha Competent E. coli (High Efficiency) | NEB | C2987H |
| One Shot™ BL21 Star™ (DE3) Chemically Competent E. coli | Thermo Fisher Scientific | C601003 |
| Biological Samples | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| DDX3X from amino acid residues 132–607 (NP-001347.3) | Stephen Floor Lab | N/A |
| Anisomycin | Sigma-Aldrich | A9789–5MG |
| Puromycin | Sigma-Aldrich | P8833–10MG |
| Emetine | Sigma-Aldrich | E2375–500MG |
| biotin-alkyne | Thermo Fisher Scientific | B10185 |
| Alexa647-alkyne | Thermo Fisher Scientific | A10278 |
| AHA | Thermo Fisher Scientific | C10102 |
| Critical Commercial Assays | ||
| Methionine-free DMEM | Thermo Fisher Scientific | 21013024 |
| Fluorescence-based click-it | Thermo Fisher Scientific | C10269 |
| Western-based click-it | Thermo Fisher Scientific | C10276 |
| NEBuilder HiFi DNA Assembly Kit | NEB | E5520S |
| Renilla Luciferase Assay System | Promega | E2810 |
| Click-it Plus OPP 594 (Puromycin Click Kit) | Thermo Fisher Scientific | C10457 |
| Deposited Data | ||
| Experimental Models: Cell Lines | ||
| Neuro2A (male) | ATCC | CCL131 |
| HEK293T (female) | ATCC | CRL-11268 |
| Experimental Models: Organisms/Strains | ||
| C57BL/6J mice (male and female) | The Jackson Laboratory | 000664 |
| CD1 mice (male and female; Figure 3B–E and Figure S2) | Animal Resource Centre | Arc:Arc(S) |
| Oligonucleotides | ||
| Formation of RNA duplex for unwinding assays: “5’ duplex” (5’-AGCACCGUAAGAGC-3’) and “3’ overhang (5’GCGUCUUUACGGUGCUUAAAACAAAACAAAACAAAACAAAA-3’) | Synthesized at IDT | |
| Transcribed RNA for ATPase assay: GGAAUCUCGCUCAUGGUCUCUCUCUCUCUCUCUCUCUCUCU | Stephen Floor lab | |
| Mouse Ddx3x siRNA pool: 5’-CTGATAATAGTCTTTAAACAA-3’, 5’-TCCATAAATAATATAAGGAAA-3’, 5’-CTCAAAGTTAATGCAAGTAAA-3’, 5’-CACAGGTGTGATACAACTTAA-3’ |
Qiagen | GS13205 |
| Negative control siRNA | Qiagen | 1022076 |
| Primers for RT-qPCR: mouse Ddx3x forward 5’- TGGAAATAGTCGCTGGTGTG-3’ and reverse 5’- GGAGGACAGTTGTTGCCTGT-3’; mouse Actb forward 5’- AGATCAAGATCATTGTCCT 3’ and reverse 5’ CCTGCTTGCTGATCCACATC 3’ | This paper (Debra Silver Lab) | |
| Primers for In Situ Hybridization (mouse): Forward primer: 5’ AAGGGAGCTCAAGGTCACAA 3’, Reverse primer: 5’ CCTGCTGCATAATTCTTCC 3’ | Allen Developing Mouse Brain Atlas | |
| Recombinant DNA | ||
| pX330-U6-Chimeric_BB-CBh-hSpCas9 | Feng Zhang Lab | AddGene plasmid # 42230; RRID:Addgene_42230 |
| Ddx3x exon 1 sgRNA (5’-AGTGGAAAATGCGCTCGGGC-3’) | This paper (Debra Silver Lab) | http://crispr.mit.edu/ |
| TCF/LEF-H2B:GFP plasmid | Anna-Katerina Hadjantonakis Lab | AddGene plasmid # 32610; RRID:Addgene_32610 |
| Dcx::mCherry plasmid | Santos Franco Lab | |
| pCAG-GFP-DDX3X | This paper (Debra Silver Lab) | pCAG-EX2 |
| pHM-GWA-6xHis-MBP-DDX3X (protein purification) | Stephen Floor Lab | pHM-GWA |
| pCMV-DDX3X_WT-FLAG-Puromycin | Stephen Floor Lab | pCMV |
| Software and Algorithms | ||
| Fiji | Schindelin, J, et al., 2012 | https://imagej.net/Fiji |
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Other | ||
| Vineland Adaptive Behavior Scales, Second Edition (Vineland-II) | Sparrow, SS. et al., 2006 | N/A |
| Child Behavior Checklist (CBCL) | Achenbach, T.M., 2011 | N/A |
| Social Communication Questionnaire (SCQ) | Rutter, M., et al., 2003 | N/A |
| Social Responsiveness Scale, Second Edition (SRS-2) | Constantino, JN., 2013 | N/A |