KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Alexa Fluor 647 mouse anti-γH2AX (pS139)	BD Biosciences	560447; RRID:AB_1645414
Rabbit monoclonal anti-AXIN2	Abcam	ab109307; RRID:AB_10862550
Rabbit polyclonal anti-AXIN1	Thermo Fisher	34–5900; RRID:AB_2533178
Rabbit monoclonal anti-c-MYC [Y69]	Abcam	ab32072; RRID:AB_731658
Rabbit anti-TNKS1 465 antiserum	(Smith et al., 1998)	N/A
Rabbit polyclonal anti-histone H3K27Ac	Active Motif	39133; RRID:AB_2561016
Rabbit polyclonal anti-acetyl-histone H3	Millipore	06–599; RRID:AB_2115283
Rabbit Anti-acetyl-histone H4 serum	Millipore	06–866; RRID:AB_310270
Mouse monoclonal anti-active-β-catenin, clone 8E7	Millipore	05–665; RRID:AB_309887
Mouse anti-β-catenin, IgG1	BD Biosciences	610153; RRID:AB_397554
eIF2α-S1(phospho S51)	Abcam	ab32157; RRID:AB_732117
Mouse monoclonal anti-YAP1	Santa Cruz Biotechnology Inc	sc-101199; RRID: AB_1131430
Rabbit monoclonal anti-eIF2α	Cell Signaling	5324; RRID:AB_10692650
Rabbit polyclonal anti-SIRT1	Cell Signaling	2028; RRID:AB_1196631
PTEN (D4.3) XP Rabbit mAb antibody	Cell Signaling Technology	9188; RRID:AB_2253290
Mouse anti-beta-actin monoclonal antibody, unconjugated, clone AC-15	Sigma	A1978; RRID:AB_476692
Alexa 488 goat anti-rabbit IgG	Thermo-Fisher	A-11034; RRID:AB_2576217
Alexa 488 donkey anti-mouse IgG	Thermo-Fisher	A-21202; RRID:AB_141607
Peroxidase-conjugated donkey anti-rabbit IgG	Jackson ImmunoResearch	711-035-152; RRID:AB_10015282
Peroxidase-conjugated goat anti-mouse IgG	Jackson ImmunoResearch	115-035-174; RRID:AB_2338512
Chemicals, Peptides, and Recombinant Proteins
IWR1-endo (IWR1)	Sigma	10161
IWR1-exo	Cayman Chemical	13598
XAV939	Sigma	X3004
iCRT3	Sigma	SML0211
iCRT14	Tocris	4299
DMSO	Thermo-Fisher	D12345
Lambda Protein Phosphatase	NEB	P0753S
Cytochalasin D	Sigma	C8273
α-amanitin	Sigma	A2263
RNase A	Thermo-Fisher	EN0531
Hyaluronidase	Sigma-Aldrich	H3884
Calf serum	Atlanta Biologicals	S11495
Minimal essential medium α (MEMα)	Thermo-Fisher	3251
MEM, Hepes (MEM)	Thermo-Fisher	12360038
EmbryoMax® KSOM Medium (KSOM)	MilliporeSigma	MR-106-D
EmbryoMax® Human Tubal Fluid (HTF)	MilliporeSigma	MR-070-D
AlbuMAX™ I Lipid-Rich BSA	Thermo-Fisher	11020021
Poly (vinyl alcohol), average MW 30-70,000 (PVA)	Sigma-Aldrich	P8136
Equine chorionic gonadotropin (eCG)	Lee Biosolutions	493-10
Human chorionic gonadotropin (hCG)	Sigma-Aldrich	C1063
IGEPAL® CA-630	Sigma-Aldrich	I8896
Dimethylformamide	Sigma-Aldrich	PHR1553
Paraformaldehyde	Electron Microscopy Sciences	15710
Milrinone	Sigma	M4659
Critical Commercial Assays
Click-iT™ Plus OPP Alexa Fluor™ 488 Protein Synthesis Assay Kit	Thermo-Fisher	C10456
Click-iT™ EdU Alexa Fluor™ 488 Imaging Kit	Thermo-Fisher	C10337
Click-iT™ RNA Alexa Fluor™ 488 Imaging Kit	Thermo-Fisher	C10329
SuperSignal™ West Femto Maximum Sensitivity Substrate	Thermo-Fisher	34095
PicoPure™ RNA Isolation Kit	Applied Biosystems™	KIT0204
SYBR™ Green PCR Master Mix	Applied Biosystems™	4309155
SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing	Takara Bio USA, Inc.	634888
QuikChange II XL Site-Directed Mutagenesis Kit	Agilent	200521
Nextera DNA Library Preparation Kit	Illumina	FC-121-1030
Nextera Index Kit (24 indexes, 96 samples)	Illumina	FC-121-1011
MinElute PCR Purification Kit	Qiagen	28004
QIAprep Spin Miniprep Kit	Qiagen	27104
AmpliCap-MaxTM T 7 High Yield Message Maker Kit	CELLSCRIPT ™	C-ACM04037
Phusion High-Fidelity PCR Master Mix	NEB	M0531S
MEGAscript™ T7 Transcription Kit	Thermo-Fisher	AM1334
MEGAclear™ Transcription Clean-Up Kit	Thermo-Fisher	AM1908
Deposited Data
Raw and processed ATAC-seq and RNA-seq data	This paper	GEO: GSE123815
Experimental Models: Organisms/Strains
Mice: Hsd:NSA(CF-1) females	Envigo	033
Mice: B6SJLF1/J males	Jackson Laboratory	100012
Mice: B6(Cg)- Ctnnb1<tm1Knw>/J	Jackson Laboratory	022775
Mice: C57BL/6-Tg(Zp3-cre)93Knw/J	Jackson Laboratory	003651
Oligonucleotides
TNKS-siRNA	Thermo-Fisher Silencer Select siRNAs	4390771 Assay ID: s75316
β-catenin siRNA	Thermo-Fisher Silencer Select siRNAs	4390771 Assay ID: s63418
Silencer Select Negative Control No. 1	Thermo-Fisher Silencer Select siRNAs	4390843
TNKS morpholino (TNKS-MO): 5′-GGTCTGCTTTGCAGTGAATATCCAT-3′	Gene Tools	N/A
β-catenin morpholino: CTTGAGTAGCCATTGTCCACGCAGC	Gene Tools	N/A
Standard Control morpholino (Ctr-MO): 5′-CCTCTTACCTCAGTTACAATTTATA-3′	Gene Tools	N/A
Primers: see Supplementary Table S8
Recombinant DNA
pIVT2-Axin2	This paper	N/A
pIVT2-Axin2-V26D	This paper	N/A
pcDNA3-S33Y Beta-catenin	Addgene (Kolligs et al., 1999)	Cat#19286
pGEMHE-mCherry-mTrim21	Addgene (Clift et al., 2017)	Cat#105522
pFLAG-TNKS-2	Addgene (Sbodio et al., 2002)	Cat#34691
pGEMHE-TNKS-2	This paper	N/A
pGEMHE-NLS-Beta-catenin-S33Y	This paper	N/A
Software and Algorithms
Prism 7	GraphPad Software	RRID:SCR_002798 URL: https://www.graphpad.com/
ImageJ	(Schneider et al., 2012)	RRID:SCR_003070 URL: https://imagej.net/
Trim Galore!	Babraham Bioinformatics	RRID:SCR_011847 URL: http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/
Bowtie 2 (v2.2.6)	(Langmead and Salzberg, 2012)	RRID:SCR_016368 URL: http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Cutadapt (v1.11)	(Martin, 2011)	RRID:SCR_011841 URL: http://code.google.com/p/cutadapt/
STAR Aligner (v2.5.1b)	(Dobin et al., 2013)	https://intranet.birmingham.ac.uk/it/teams/infrastructure/research/bear/bluebear/applications/star-aligner-v2-5.1b.aspx
featureCounts (v1.5.0-p1)	(Liao et al., 2014)	RRID:SCR_012919 URL: http://bioinf.wehi.edu.au/featureCounts/
DESeq2	(Love et al., 2014)	RRID:SCR_015687 URL: https://bioconductor.org/packages/release/bioc/html/DESeq2.html
MACS2	(Feng et al., 2012)	http://liulab.dfci.harvard.edu/MACS/
Gene Set Enrichment Analysis (GSEA)	(Subramanian et al., 2005)	RRID:SCR_003199 URL: http://www.broadinstitute.org/gsea/
Ingenuity® Pathway Analysis version 01-07	Qiagen Inc.	N/A
Other