KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal Anti-Axin 2 | Abcam | Cat# ab109307; RRID:AB_10862550 |
| Rabbit polyclonal Anti-CD31 | Abcam | Cat# ab28364; RRID:AB_726362 |
| Rat monoclonal Anti-CD45 | BioLegend | Cat# 103144; RRID:AB_2563458 |
| Rabbit Anti-Calcitonin Gene Related Peptide | Sigma-Aldrich | Cat# C8198; RRID:AB_259091 |
| Rat monoclonal Anti-F4/80 | Abcam | Cat# ab204467; RRID:AB_2810932 |
| Rabbit polyclonal Anti-Human Gli1 | Abcam | Cat# ab49314; RRID:AB_880198 |
| Rabbit polyclonal Anti-IL-1 beta | Abcam | Cat# ab9722; RRID:AB_308765 |
| Rabbit polyclonal Anti-NGF | Abcam | Cat# ab6199; RRID:AB_2152414 |
| Rabbit polyclonal Anti-Osteocalcin | Abcam | Cat# ab93876; RRID:AB_10675660 |
| Rabbit polyclonal Anti-PDGF receptor alpha | Abcam | Cat# ab15501; RRID:AB_301910 |
| Rabbit polyclonal Anti-PGP 9.5 | Agilent Tech | Cat# Z511601-2 |
| Rabbit polyclonal Anti-TNF alpha | Abcam | Cat# ab6671; RRID:AB_305641 |
| Rabbit polyclonal Anti-neuron specific beta III Tubulin | Abcam | Cat# ab18207; RRID:AB_444319 |
| Goat Anti-Mouse IgG H&L (Alexa Fluor® 647) preadsorbed antibody | Abcam | Cat# ab150119; RRID:AB_2811129 |
| DyLight 594 Anti-Rabbit IgG (H+L), made in goat antibody | Vector Laboratories | Cat# DI-1594; RRID:AB_2336413 |
| Bacterial and Virus Strains | ||
| Human Adenovirus Type5 (dE1/E3) | Vector Biosystems | Cat# 1045, Ad-CMV-iCre |
| Human Adenovirus Type5 (dE1/E3) | Vector Biosystems | Cat# 1060, Ad-GFP |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Small molecule 1NMPP1 | Aurora Analytics | Cat# N 0001 |
| DAPI mounting solution | Vector Laboratories | Vectashield H-1500 |
| 14% Ethylenediaminetetraacetic acid | Sigma-Aldrich | Cat# E6511 |
| Critical Commercial Assays | ||
| NF-KappaB Pathway Sampler Kit - 1 Kit | Cell Signaling | 9936T |
| iScript cDNA Synthesis Kit | Bio-Rad | Cat# 1708891 |
| Experimental Models: Organisms/Strains | ||
| Mouse: C57BL/6J | The Jackson Laboratory | Stock #000664 |
| Mouse: mT/mG | The Jackson Laboratory | Stock #007576 |
| Mouse: TdTomato | Donated from Cao laboratory, Jackson Laboratory | Stock #007914 |
| Mouse: NGF-eGFP | Donated from Kawaja laboratory | N/A |
| Mouse: Ngffl/fl | Donated from Minichiello laboratory | N/A |
| Mouse: Thy1-YFP | The Jackson Laboratory | Stock #003709 |
| Mouse: TrkAF592A | Donated from Ginty laboratory, Jackson Laboratory | Stock #022362 |
| Mouse: Pdgfrα-CreERT2 | Donated from Bergles laboratory, Jackson Laboratory | Stock #018280 |
| Mouse: LysM-Cre | Jackson Laboratory | Stock #004781 |
| Oligonucleotides | ||
| Primer: Gapdh Forward: 5′- GAC TTC AAC AGC AAC TCC CAC –3′ | Thermo Scientific | N/A |
| Primer: Gapdh Reverse: 5′- TCC ACC CTG TTG CTG TA –3′ | Thermo Scientific | N/A |
| Primer: Ngf Forward: 5′- ACACTCTGATCACTGCGTTTTTG –3′ | Thermo Scientific | N/A |
| Primer: Ngf Reverse: 5′-CCTTCTGGGACATTGCTATCTGT-3′ | Thermo Scientific | N/A |
| Primer: eGFP Forward: 5′- CAACCACTACCTGAGCACCC –3′ | Thermo Scientific | N/A |
| Primer: eGFP Reverse: 5′- GTCCATGCCGAGAGTGATCC –3′ | Thermo Scientific | N/A |
| Software and Algorithms | ||
| Leica DM6 | Leica Microsystems Inc. | https://www.leica-microsystems.com/ |
| Zeiss LSM780 FCS | Carl Zeiss Microscopy GmbH | https://www.zeiss.com/ |
| SkyScan1172 high-resolution microCT imaging system | Bruker | https://www.bruker.com/ |
| NRecon software 2.0.4.0 | Bruker SkyScan | https://www.bruker.com/ |
| CTVox & CTAn software 1.13 | Bruker SkyScan | https://www.bruker.com/ |
| Photoshop CC, 2017 | Adobe | https://www.adobe.com/ |
| Imaris software v9.3 | Oxford Instruments | https://www.oxinst.com/ |